ID: 978184188

View in Genome Browser
Species Human (GRCh38)
Location 4:105837443-105837465
Sequence CCATGTGGCCCTTCATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 224}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978184175_978184188 30 Left 978184175 4:105837390-105837412 CCTCACCTTTTTCTTCCCATGGA 0: 1
1: 0
2: 3
3: 66
4: 361
Right 978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG 0: 1
1: 0
2: 0
3: 21
4: 224
978184176_978184188 25 Left 978184176 4:105837395-105837417 CCTTTTTCTTCCCATGGAAACCG 0: 1
1: 0
2: 6
3: 46
4: 250
Right 978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG 0: 1
1: 0
2: 0
3: 21
4: 224
978184181_978184188 2 Left 978184181 4:105837418-105837440 CCTCCTGACCTATACTGGTGTTT 0: 1
1: 0
2: 3
3: 22
4: 151
Right 978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG 0: 1
1: 0
2: 0
3: 21
4: 224
978184182_978184188 -1 Left 978184182 4:105837421-105837443 CCTGACCTATACTGGTGTTTCCC 0: 1
1: 0
2: 1
3: 18
4: 137
Right 978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG 0: 1
1: 0
2: 0
3: 21
4: 224
978184180_978184188 5 Left 978184180 4:105837415-105837437 CCGCCTCCTGACCTATACTGGTG 0: 1
1: 0
2: 2
3: 7
4: 123
Right 978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG 0: 1
1: 0
2: 0
3: 21
4: 224
978184178_978184188 14 Left 978184178 4:105837406-105837428 CCATGGAAACCGCCTCCTGACCT 0: 1
1: 0
2: 3
3: 19
4: 140
Right 978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG 0: 1
1: 0
2: 0
3: 21
4: 224
978184183_978184188 -6 Left 978184183 4:105837426-105837448 CCTATACTGGTGTTTCCCCATGT 0: 1
1: 0
2: 6
3: 23
4: 157
Right 978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG 0: 1
1: 0
2: 0
3: 21
4: 224
978184177_978184188 15 Left 978184177 4:105837405-105837427 CCCATGGAAACCGCCTCCTGACC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG 0: 1
1: 0
2: 0
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978184188 Original CRISPR CCATGTGGCCCTTCATCACA TGG Intronic
900900650 1:5513514-5513536 CCCTGTGGCACTTCTTCTCATGG + Intergenic
901957226 1:12795310-12795332 CCATGAGGACCATCATCAGATGG + Intronic
901965243 1:12861089-12861111 CCATGAGGACCATCATCAGATGG + Intronic
901980635 1:13031444-13031466 CCATGAGGACCATCATCAGATGG + Intronic
902001454 1:13197487-13197509 CCATGAGGACCATCATCAGATGG - Intronic
902020689 1:13343192-13343214 CCATGAGGACCATCATCAGATGG - Intronic
906480269 1:46194866-46194888 CCATGTGTCCCTCCAGCCCAGGG + Exonic
908130834 1:61073976-61073998 TCATGTGTCACTTCATGACAGGG - Intronic
908578364 1:65486471-65486493 ATATGTGGTCCTTCACCACATGG - Intronic
915871016 1:159559660-159559682 CCATGTGGCCTTTCATCCCTAGG + Intergenic
917070742 1:171147884-171147906 CTATGTGGCCCTTCAAATCAAGG + Intronic
919248997 1:195029170-195029192 GCATGGAGCCCTTCATTACAAGG - Intergenic
920011770 1:202873377-202873399 CCATGTTCCCCTCCATCACTGGG + Intergenic
920379180 1:205526044-205526066 CGCTGTGGCCCTCCATCCCAGGG + Exonic
920682312 1:208082538-208082560 TCATGTGGCTCTCTATCACAGGG + Intronic
920955925 1:210620081-210620103 CCCTGTGGTCCTTCATCACCGGG - Intronic
921811811 1:219523501-219523523 CTCTGTGTCCCTTCACCACATGG + Intergenic
923039117 1:230307274-230307296 CCATGAGGCCCTTCAGCACTGGG + Intergenic
923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG + Intergenic
923258277 1:232241301-232241323 CCATGTGGCCCTTCATAGTGAGG + Intergenic
923602006 1:235411858-235411880 CCCTGTGCCCCTTCAGGACAAGG + Intronic
924015870 1:239721963-239721985 AAATGTGTCCCTTCAACACAAGG + Intronic
924941582 1:248815887-248815909 CCGTGTGGCCCTGCATGGCATGG + Intronic
1063165754 10:3460333-3460355 CCCAGTTGCCCTTCATCACATGG + Intergenic
1066351722 10:34642394-34642416 CCATCTGGCCCTGCCTCTCACGG + Intronic
1067208799 10:44241852-44241874 GCATGTGGACCTTTGTCACAGGG - Intergenic
1072636758 10:97183251-97183273 CCATGTGCCCCTTGAGGACAGGG + Intronic
1072766359 10:98097874-98097896 CTATGTTTCCCCTCATCACAGGG + Intergenic
1073010157 10:100352773-100352795 CGTTGTGGCTCTTCATCATAAGG + Intronic
1074720017 10:116256397-116256419 ACATGTTGCCCTTCCTCCCAGGG + Intronic
1075016839 10:118915893-118915915 CCTTCTGCCCCTTCAACACAGGG + Intergenic
1075538719 10:123294571-123294593 CCATATTGTCCTTCCTCACAGGG - Intergenic
1076746348 10:132516811-132516833 CCATGTGTCACTGAATCACATGG - Intergenic
1079289735 11:19176857-19176879 TCATGTGGCCTTTCATTGCAAGG + Intergenic
1080614866 11:33937132-33937154 CTATGAGGCCCTTTATCACCGGG - Intergenic
1080708008 11:34717156-34717178 CTATCTGCCTCTTCATCACATGG + Intergenic
1080714908 11:34790736-34790758 CCATGTGGCTTCTCATGACATGG - Intergenic
1081459633 11:43260096-43260118 CCTTGTGTCCCTGCTTCACAAGG + Intergenic
1081552520 11:44127282-44127304 CTATCTGGCCTTTCATCACAGGG + Intronic
1081855629 11:46301496-46301518 GCATGATGCCCTCCATCACATGG + Intronic
1082291620 11:50381354-50381376 TCATGTGGACATTCATCTCATGG + Intergenic
1082310636 11:50643227-50643249 TGATGTGTCCATTCATCACACGG + Intergenic
1083199985 11:61115091-61115113 CCATGTGGCTCTTCCTTACCTGG - Exonic
1084067716 11:66714899-66714921 CCAACTGGTCCTTCACCACAGGG - Intronic
1084251046 11:67899518-67899540 CCATCTGGCCACTCATGACATGG - Intergenic
1084462769 11:69305307-69305329 CCCTCTGGGCCTTCATCAGAAGG + Intronic
1084821793 11:71696529-71696551 CCATCTGGCCGCTCATGACATGG + Intergenic
1088882924 11:113985937-113985959 ACCTGTGTCCCATCATCACAGGG + Intronic
1090415052 11:126534916-126534938 CCACGTGGCCCATCAGGACAGGG - Intronic
1091989701 12:4945320-4945342 ACATGTGGCCCTTTGTCTCAAGG + Intergenic
1092020064 12:5194327-5194349 CCTTGTGGCTTTCCATCACAGGG - Intergenic
1092421307 12:8334312-8334334 CCATCTGGCCGCTCATGACATGG - Intergenic
1094782225 12:33803970-33803992 CCATGTGGTGATTTATCACAGGG - Intergenic
1095822821 12:46497897-46497919 TCATGTGTCCCTTAATGACAGGG - Intergenic
1096461829 12:51825956-51825978 TCATTTGGCCCTTCATTACCTGG + Intergenic
1096591376 12:52662134-52662156 CTAAGTGGCCATTCATTACAAGG + Intergenic
1097153847 12:56998337-56998359 CCATTTGGCCCCACAGCACATGG - Intergenic
1099375513 12:81892893-81892915 CCATTTGGCCTTTCCTAACATGG - Intergenic
1100708614 12:97229044-97229066 CTGTGAGGCCCTTCATCACCTGG + Intergenic
1101031975 12:100669535-100669557 GCATGTGCCCCTTAATAACAAGG + Intergenic
1106462255 13:29981446-29981468 CCTTGTGGCCCTTCATTTCTTGG + Intergenic
1107269376 13:38596528-38596550 TCATGTGTCCCTTAATGACAGGG + Intergenic
1114031950 14:18586211-18586233 CCATGTGGGCTTTAATCATAAGG - Intergenic
1121565880 14:94908752-94908774 CCCTGGGTCCCTTCCTCACAAGG + Intergenic
1124722370 15:32121191-32121213 CCATGTGGCCCTGGCCCACAAGG - Intronic
1125726076 15:41868739-41868761 ACATGTGGCCCTTTGTCACTTGG + Intronic
1127454254 15:59143220-59143242 CCATTTGGCCCTTTATCACTAGG + Intronic
1129484252 15:75853913-75853935 CCATAGGGCACCTCATCACATGG + Intronic
1130271678 15:82454124-82454146 CCATAGGGCACCTCATCACATGG + Intergenic
1130464026 15:84181511-84181533 CCATAGGGCACCTCATCACATGG + Intronic
1130474827 15:84255441-84255463 CCATAGGGCACCTCATCACATGG + Intergenic
1130482243 15:84369497-84369519 CCATAGGGCACCTCATCACATGG + Intergenic
1130488658 15:84413322-84413344 CCATAGGGCACCTCATCACATGG - Intergenic
1130500241 15:84492030-84492052 CCATAGGGCACCTCATCACATGG - Intergenic
1130507796 15:84562509-84562531 CCATAGGGCACCTCATCACATGG - Intergenic
1130586322 15:85186143-85186165 CCATAGGGCACCTCATCACATGG + Intergenic
1130916292 15:88307563-88307585 CCAACTGGCCCTTTATCAGATGG + Intergenic
1131237712 15:90711255-90711277 CCATGTGGCCCTGCATGGCGTGG + Intergenic
1132428128 15:101737822-101737844 CCATAGGGCACCTCATCACATGG - Intronic
1133219671 16:4314674-4314696 GCACGTGGCTCTTGATCACAAGG - Intergenic
1133377039 16:5295629-5295651 CCATCTGGCCGCTCATGACATGG + Intergenic
1135073138 16:19369921-19369943 TAATGTGGACCTTCATCACCTGG - Intergenic
1135309600 16:21395204-21395226 CCATGTGGCCAAGCATCAAAAGG - Intergenic
1135529909 16:23244376-23244398 CCATGTGGGCCTCCTCCACAGGG - Intergenic
1136149177 16:28335517-28335539 CCATGTGGCCAAGCATCAAAAGG - Intergenic
1136306344 16:29374328-29374350 CCATGTGGCCAAGCATCAAAAGG - Intergenic
1137274099 16:46922284-46922306 CCAGCTGGCCCTTGATCTCAGGG - Exonic
1137820611 16:51441187-51441209 CCCTATGGCAATTCATCACATGG - Intergenic
1137896597 16:52219413-52219435 CCATGCTCCCCTTCACCACAGGG + Intergenic
1138294391 16:55874013-55874035 CTCTGTGGCCCTTCAGCAGAAGG + Exonic
1139486254 16:67258247-67258269 CCAGGTGGCCCTTCCTCAGACGG - Intronic
1140234346 16:73145059-73145081 CCATGGGGGCTTTCAGCACAGGG - Intergenic
1141047038 16:80724565-80724587 ACATGTGGCACTTCATGACCTGG + Intronic
1141095234 16:81158513-81158535 CCATGTTGTCCTGCACCACAAGG - Intergenic
1141818326 16:86428108-86428130 CAATGTGGCCCTTCATTTTATGG + Intergenic
1142059473 16:88020161-88020183 CCGTGTGGCCCTTCAGAAGAAGG - Intronic
1142182474 16:88677998-88678020 CCCTGTGGCCCTTCCTCAGTAGG - Exonic
1143044298 17:4064395-4064417 CCATGACGTCCTTCAGCACAGGG + Exonic
1148717324 17:49725045-49725067 CCATCTGACCCTTCATCCCACGG + Intronic
1150412505 17:64957521-64957543 ACATGTTGCCCTTAATCAAATGG - Intergenic
1151457067 17:74232598-74232620 CCATGGGGCCCTTCCCCACCAGG - Intronic
1157524267 18:48367676-48367698 CCATGTGGCCTTTGCTGACATGG - Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1163298211 19:16426142-16426164 CCATGTTGACATTCATCACTGGG - Intronic
1163669967 19:18621662-18621684 CAATTTGTCCCTTCATAACAGGG - Intergenic
1163840198 19:19603140-19603162 CCATGTGGCCCTGCCTGGCATGG + Intronic
1164823727 19:31268859-31268881 CCATGTGCCATTTCAACACAGGG + Intergenic
1165639667 19:37373688-37373710 TCAGGTGTCCCTTCATCAGAGGG - Intronic
1166295093 19:41885043-41885065 CCATGTGGCCCCCCAACCCATGG + Intronic
1167660612 19:50793977-50793999 CCATGTGGCACTGCTTCCCAAGG - Intronic
1168583446 19:57574412-57574434 TCATGTGGCCCTGCATGGCATGG + Intronic
926315335 2:11705531-11705553 CCAAGTGTCCCTTCCTCATAGGG - Intronic
928099771 2:28429990-28430012 CCATCAGGCCCTGCATGACATGG - Intergenic
928312308 2:30221087-30221109 CTCAGTGGCCGTTCATCACATGG + Intergenic
930686881 2:54318987-54319009 CCACGTGGCCCTGCATGGCATGG + Intergenic
932541644 2:72661172-72661194 CCAATTGCCCCTTCATCCCAAGG - Intronic
933353106 2:81180863-81180885 CCATGTGTCACTTAATGACAGGG - Intergenic
935123478 2:100202056-100202078 CCATGTGGCCCTGCATGGCATGG + Intergenic
937205105 2:120231319-120231341 CCCTGTGGCCCTTGTTCCCAAGG + Intergenic
938986706 2:136583570-136583592 CCATGAGTCCCTTCAGGACAAGG - Intergenic
939179313 2:138785338-138785360 CCAGGTGCCCTTTCATCACAGGG - Intergenic
940597067 2:155808147-155808169 TCATGTGTCCCTTAATGACAGGG - Intergenic
943604626 2:189962375-189962397 CCATGTGTCACTTAATGACAGGG - Intronic
946820149 2:223620626-223620648 CCACGTGGCCCTGCATGGCATGG + Intergenic
947352851 2:229264449-229264471 CCTTGTGGCCCTTGATCACTTGG - Intronic
1171990874 20:31695333-31695355 CCATGTGGCCCTACAAGACCTGG + Intronic
1173817467 20:45998948-45998970 CCATGTGGCCCTGTGTGACATGG - Intergenic
1174077866 20:47951088-47951110 CCATGTGGCCCTGCAGAGCACGG - Intergenic
1174077894 20:47951183-47951205 CCATGTGGCCCTGCAGAGCACGG - Intergenic
1174077943 20:47951334-47951356 CCATGTGGCCCTGCAGAGCACGG - Intergenic
1174077972 20:47951421-47951443 CCATGTGGCCCTGCAGAGCACGG - Intergenic
1174077987 20:47951465-47951487 CCATGTGGCCCTGCAGAGCACGG - Intergenic
1176322567 21:5347771-5347793 TCATGTGTGCCTTCATCTCACGG + Intergenic
1176480219 21:7279391-7279413 TCATGTGTGCCTTCATCTCACGG + Intergenic
1179018329 21:37614975-37614997 ACATGTGGCCTGTTATCACATGG - Exonic
1180456064 22:15513268-15513290 CCATGTGGGCTTTAATCATAAGG - Intergenic
1181767360 22:25101351-25101373 CCATGTGGCCCTGCCTGGCATGG - Intronic
1182473664 22:30564115-30564137 CCAGCTGACCCTCCATCACAGGG + Intronic
1183320818 22:37164138-37164160 CCATGTAGCCTGTCAACACAGGG + Intronic
949122465 3:403195-403217 CCATGGGGCCATTCACAACATGG + Intronic
949870484 3:8583745-8583767 CCATGTGGCCCTGCATGGCACGG + Intergenic
950427481 3:12932235-12932257 CCATGCAGCCCTGCAGCACATGG - Intronic
952597960 3:35042332-35042354 CCATGTGTCCCATCATCCAAAGG - Intergenic
952748041 3:36800623-36800645 CCATATGGCCCTGCATGGCATGG - Intergenic
955542367 3:59991091-59991113 AGATGTGGCCCTTGATCTCATGG - Intronic
956488712 3:69748766-69748788 CAATGATGCCCTTAATCACATGG - Intronic
957101012 3:75828583-75828605 TCATGTGTCACTTCATGACAGGG + Intergenic
958700138 3:97578501-97578523 CCATATGGCCCTTAACGACAGGG + Intronic
960263382 3:115593366-115593388 CCATGTGGCCCTGCATAGCATGG - Intergenic
961288065 3:125822520-125822542 CCATCTGGCCACTCATGACATGG + Intergenic
961737005 3:129008658-129008680 CTTTGTGGCCCCTCAGCACATGG - Intronic
961898989 3:130193522-130193544 CCATCTGGCCGCTCATGACATGG - Intergenic
962329646 3:134466191-134466213 TCATGTGTCACTTAATCACAGGG - Intergenic
965528476 3:169746843-169746865 ACATGTGGCCCATCTACACAGGG - Intergenic
966832969 3:184026662-184026684 CCATGTGGCAATTCAGTACAGGG + Intergenic
969009843 4:4052970-4052992 CCATCTGGCCACTCATGACATGG - Intergenic
969322944 4:6424085-6424107 CCAGGAGGCTCTTCCTCACAGGG + Intronic
969744388 4:9058288-9058310 CCATCTGGCCACTCATGACATGG + Intergenic
969803792 4:9590399-9590421 CCATCTGGCCGCTCATGACATGG + Intergenic
970385324 4:15550172-15550194 CAATGGGGCCCTTCACCTCATGG + Intronic
971895051 4:32581266-32581288 ACATGTGGTCATTTATCACAAGG + Intergenic
973082061 4:46005484-46005506 CAATGTGGCCCTTAAGCAGAAGG - Intergenic
976087995 4:81425789-81425811 CCCTGTGGCCCTGCATGGCATGG + Intergenic
978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG + Intronic
981633394 4:146847607-146847629 CAGTGTGGCCCTTCTGCACATGG - Intronic
982532659 4:156565756-156565778 CCATGTGGTTGTTAATCACAGGG - Intergenic
982973410 4:162020652-162020674 CCATTTGACTGTTCATCACATGG + Intronic
983098752 4:163598380-163598402 CCATGCGTCCCTTAATGACAGGG + Intronic
984242691 4:177236770-177236792 CCATGTGGTCCTGCATGGCATGG - Intergenic
984867532 4:184294794-184294816 CCACGTGGCCCTGCATGGCATGG + Intergenic
985745373 5:1643794-1643816 CCATGTGGCCCTGAGTCACCGGG + Intergenic
986461703 5:7979333-7979355 CCTTGTGGCTCTTCCACACAGGG + Intergenic
988688848 5:33551287-33551309 CAATCTGTCCCCTCATCACATGG - Intronic
989286213 5:39703032-39703054 CCATGGGGCGCTTAATCACTTGG - Intergenic
989458709 5:41671175-41671197 CCATTTAGCCCTTCACCCCAGGG - Intergenic
990213722 5:53508127-53508149 CCCCCTGGCCCATCATCACATGG + Intergenic
992648009 5:78830318-78830340 GCAGCTGGCCCTTCATCAAATGG + Intronic
994066144 5:95544896-95544918 GCCTGTGGCGCTTTATCACATGG - Intronic
998857276 5:146405585-146405607 CCATGTGGTCCTGCATGACATGG - Intergenic
999529942 5:152451985-152452007 CGATGTTGCCCTTGATCACCTGG + Intergenic
1000712208 5:164594990-164595012 CCAGAAGCCCCTTCATCACAGGG + Intergenic
1001233330 5:170008807-170008829 CCCTGTGGCCCTCCAACAGATGG - Intronic
1004493867 6:16144936-16144958 CCAAGTGGCCCTTCAAGTCACGG - Exonic
1005418592 6:25626907-25626929 CCATGTGGCCCTGCATGGTATGG - Intergenic
1007938099 6:45751798-45751820 CAATGTGGCCCATCACCAAAGGG + Intergenic
1008682666 6:53890489-53890511 CCATGTGGCCCCCGGTCACAAGG + Intronic
1012277212 6:97289050-97289072 CCATGTGGGCCTTTCTAACATGG - Intergenic
1014164154 6:118204454-118204476 TCATTTGTCCCTTTATCACAGGG - Intronic
1014259636 6:119201645-119201667 TCATGTGTCCCTTAATGACAGGG + Intronic
1015999684 6:139029601-139029623 CCCTGCAGCCCATCATCACACGG - Intronic
1018064834 6:160117617-160117639 CCATGTGGGCCTCCACCACAGGG + Intergenic
1019791995 7:3020638-3020660 CCATTTGGGCCCTCAACACATGG - Intronic
1022807866 7:33841163-33841185 CCATGTGGGCATTCCTAACATGG - Intergenic
1023244497 7:38186821-38186843 CCATGTGTCACTTAATGACAGGG - Intronic
1027007430 7:74707276-74707298 CCCTGTGCCCCTTATTCACACGG + Intronic
1029068944 7:97879532-97879554 CCATCTGGCCACTCATGACATGG - Intergenic
1029986644 7:104928873-104928895 CCTTGTGTCACTTCGTCACATGG + Intergenic
1030447615 7:109667189-109667211 CCATGTTCCCTTTTATCACAGGG - Intergenic
1031035234 7:116781275-116781297 CCATGTGACCCTGCATGACAGGG + Intronic
1032498440 7:132380488-132380510 TAATGTGGCCCTTCATCTCCTGG + Intronic
1032735725 7:134691153-134691175 CCATGAGTCTCTTCATCTCATGG - Intergenic
1032903571 7:136338457-136338479 TGATGTGGCCATTCAACACATGG - Intergenic
1033318999 7:140322738-140322760 CCATGTGGCCCTACATGGCCTGG - Intronic
1035702950 8:1651273-1651295 CTGTGTGGCCCTTCTTCACAGGG + Intronic
1036251247 8:7164707-7164729 CCATCTGGCCGCTCATGACATGG - Intergenic
1036366240 8:8122753-8122775 CCATCTGGCCGCTCATGACATGG + Intergenic
1036884657 8:12542906-12542928 CCATCTGGCCACTCATGACATGG - Intergenic
1037805082 8:22054514-22054536 CCCTCTGGCCCTTCAGCACAAGG + Intronic
1037939990 8:22944073-22944095 CCATGTGGCCCTGCATGATATGG + Intronic
1037994246 8:23341116-23341138 CCACGTAGCCCTCCATCACTGGG + Exonic
1039699180 8:39944933-39944955 CTATGTGGCCTTTCAACACCTGG + Intronic
1040551378 8:48440033-48440055 CCAAGTTTCCCTTCCTCACAGGG - Intergenic
1041461313 8:58114907-58114929 CCTTGCTGCCCTTCATCAGAGGG - Intronic
1042194603 8:66221546-66221568 CCAGCTGGTCCTTCAACACAAGG + Intergenic
1042524168 8:69747143-69747165 CCCTGTGGCCCTGCATGGCAAGG + Intronic
1042811321 8:72828388-72828410 CTATGAGGCCATTCATCATATGG + Intronic
1043356407 8:79417661-79417683 CCATGTGGCCATTGGTAACATGG - Intergenic
1045028939 8:98117076-98117098 CCATGTCGTCCTTGATCAGAAGG - Exonic
1045354324 8:101371952-101371974 ACATGTGAACCTTCATCCCAAGG - Intergenic
1048177185 8:132163384-132163406 CCATGGGGCCCTACACCATATGG + Intronic
1049788021 8:144460457-144460479 CCATGTGGCCCATCACCACCAGG + Intronic
1050132669 9:2428882-2428904 CTATGTGGCCCTGCATGATATGG - Intergenic
1050426719 9:5519038-5519060 CCATGTGGCCCTTTGTGGCATGG - Intronic
1051534485 9:18141602-18141624 CCAAGTAGCCTTCCATCACAAGG + Intergenic
1051795573 9:20865569-20865591 CCATGTGGCCATACGGCACATGG - Intronic
1052739539 9:32380258-32380280 CCAGGTGTCCCTACATTACATGG + Intergenic
1053034583 9:34813660-34813682 CCATGTGGGCCTTCCCAACATGG + Intergenic
1056138193 9:83649342-83649364 CCATCTGGCCCTTCTTCCCTGGG - Intergenic
1056372700 9:85973234-85973256 CTCTATGGCCCTACATCACATGG - Intronic
1057199274 9:93131730-93131752 CCCTGTGGCCCTTCATGTGAGGG - Intronic
1057694504 9:97313689-97313711 CCATTCTGCCCTTCATCAGAAGG - Intronic
1058483148 9:105417296-105417318 CCATGTTGCCTTTCACAACAGGG + Intronic
1061141455 9:128769991-128770013 CCCTGTGACCCTGTATCACAAGG + Intronic
1062094089 9:134694214-134694236 CCAAGTGGCCCTGGATCACGGGG + Intronic
1187921207 X:24203621-24203643 GCATGAGGCCCTTCATGACCTGG + Intronic
1189584262 X:42441759-42441781 TCATGTGGCCCTGCATGCCACGG + Intergenic
1190246671 X:48695470-48695492 CCAGGTGGCCCTCCTTTACACGG - Intergenic
1192147667 X:68692959-68692981 CTCTCTGGCCTTTCATCACAAGG - Intronic
1195868235 X:109456801-109456823 CCATGGTGCCCTTCAGCAAAGGG + Intronic
1196752661 X:119131687-119131709 CCATGTGGCCCTCGACAACATGG - Intronic
1197976189 X:132168298-132168320 GCATGTGGCTCTTCGTCTCAGGG + Intergenic
1200215158 X:154365045-154365067 CCATGTGGCCCCTCATCATCAGG + Intronic
1202371186 Y:24197126-24197148 CCATAGGGCACCTCATCACATGG - Intergenic
1202376159 Y:24239435-24239457 CCATAGGGCACCTCATCACATGG - Intergenic
1202494621 Y:25430683-25430705 CCATAGGGCACCTCATCACATGG + Intergenic
1202499598 Y:25472991-25473013 CCATAGGGCACCTCATCACATGG + Intergenic