ID: 978186173 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:105858890-105858912 |
Sequence | TAATTGAGTGAGTGTGGTTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 279 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 21, 4: 253} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
978186173_978186175 | 11 | Left | 978186173 | 4:105858890-105858912 | CCAGAACCACACTCACTCAATTA | 0: 1 1: 0 2: 4 3: 21 4: 253 |
||
Right | 978186175 | 4:105858924-105858946 | TATTAAATTTTTACATCCAGCGG | 0: 1 1: 1 2: 0 3: 31 4: 344 |
||||
978186173_978186178 | 27 | Left | 978186173 | 4:105858890-105858912 | CCAGAACCACACTCACTCAATTA | 0: 1 1: 0 2: 4 3: 21 4: 253 |
||
Right | 978186178 | 4:105858940-105858962 | CCAGCGGGCTGTTTTCTGTTTGG | 0: 1 1: 0 2: 1 3: 5 4: 107 |
||||
978186173_978186176 | 12 | Left | 978186173 | 4:105858890-105858912 | CCAGAACCACACTCACTCAATTA | 0: 1 1: 0 2: 4 3: 21 4: 253 |
||
Right | 978186176 | 4:105858925-105858947 | ATTAAATTTTTACATCCAGCGGG | 0: 1 1: 0 2: 3 3: 30 4: 264 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
978186173 | Original CRISPR | TAATTGAGTGAGTGTGGTTC TGG (reversed) | Intronic | ||