ID: 978186174

View in Genome Browser
Species Human (GRCh38)
Location 4:105858896-105858918
Sequence CTGCAATAATTGAGTGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978186174_978186176 6 Left 978186174 4:105858896-105858918 CCACACTCACTCAATTATTGCAG 0: 1
1: 0
2: 2
3: 24
4: 240
Right 978186176 4:105858925-105858947 ATTAAATTTTTACATCCAGCGGG 0: 1
1: 0
2: 3
3: 30
4: 264
978186174_978186175 5 Left 978186174 4:105858896-105858918 CCACACTCACTCAATTATTGCAG 0: 1
1: 0
2: 2
3: 24
4: 240
Right 978186175 4:105858924-105858946 TATTAAATTTTTACATCCAGCGG 0: 1
1: 1
2: 0
3: 31
4: 344
978186174_978186178 21 Left 978186174 4:105858896-105858918 CCACACTCACTCAATTATTGCAG 0: 1
1: 0
2: 2
3: 24
4: 240
Right 978186178 4:105858940-105858962 CCAGCGGGCTGTTTTCTGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978186174 Original CRISPR CTGCAATAATTGAGTGAGTG TGG (reversed) Intronic