ID: 978186178

View in Genome Browser
Species Human (GRCh38)
Location 4:105858940-105858962
Sequence CCAGCGGGCTGTTTTCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978186174_978186178 21 Left 978186174 4:105858896-105858918 CCACACTCACTCAATTATTGCAG 0: 1
1: 0
2: 2
3: 24
4: 240
Right 978186178 4:105858940-105858962 CCAGCGGGCTGTTTTCTGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 107
978186173_978186178 27 Left 978186173 4:105858890-105858912 CCAGAACCACACTCACTCAATTA 0: 1
1: 0
2: 4
3: 21
4: 253
Right 978186178 4:105858940-105858962 CCAGCGGGCTGTTTTCTGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978186178 Original CRISPR CCAGCGGGCTGTTTTCTGTT TGG Intronic