ID: 978191440

View in Genome Browser
Species Human (GRCh38)
Location 4:105917301-105917323
Sequence GTAGAAATTCACCATGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978191440_978191444 25 Left 978191440 4:105917301-105917323 CCATTCCCATGGTGAATTTCTAC 0: 1
1: 0
2: 0
3: 22
4: 181
Right 978191444 4:105917349-105917371 TTCCTCTTGAAAGTTTTTCCTGG 0: 1
1: 0
2: 2
3: 45
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978191440 Original CRISPR GTAGAAATTCACCATGGGAA TGG (reversed) Intronic
900840120 1:5042024-5042046 CTAGGAATTCGCCCTGGGAAGGG - Intergenic
900846282 1:5104567-5104589 GTTGAGATTCACAATGGGGATGG + Intergenic
902690288 1:18106847-18106869 ATAGAATTTCACCATTGGTAGGG - Intergenic
908384118 1:63624339-63624361 GCACAAATTCACCATGCGCACGG - Intronic
909145292 1:71922542-71922564 ATAGAATTTCTCCATGAGAAGGG + Intronic
910266968 1:85348210-85348232 AGAGAATTTGACCATGGGAAGGG + Intronic
910795540 1:91093991-91094013 ATAAAAATTCACCATTGTAAGGG + Intergenic
911811521 1:102288498-102288520 GAAGAAATTCAAAATGTGAACGG + Intergenic
912273159 1:108230287-108230309 GGAGAAATGCAAAATGGGAAAGG + Intronic
912273172 1:108230412-108230434 GGAGAAATGCAAAATGGGAAAGG + Intronic
912295048 1:108463910-108463932 GGAGAAATGCAAAATGGGAAAGG - Intronic
912295061 1:108464035-108464057 GGAGAAATGCAAAATGGGAAAGG - Intronic
918858494 1:189790632-189790654 GTAAAAATTCACTTTGGAAAAGG + Intergenic
919706567 1:200681907-200681929 GTGGAAATAAACCATGGGAAAGG + Intergenic
923334264 1:232953154-232953176 GAAGAAATTCAGAAAGGGAAGGG - Intronic
1065322381 10:24521600-24521622 GGAGAAACTCACCTTGGGCAAGG - Intronic
1066004271 10:31133004-31133026 GTAGAAACTTACCAGGAGAAAGG - Intergenic
1066531515 10:36345435-36345457 GTAGTAATTATCCATGGGCAGGG + Intergenic
1067232232 10:44419937-44419959 GTAGGAATTCTCCATGGGTGTGG + Intergenic
1069307981 10:66995764-66995786 GTAGAAATTCATCAGGTTAAAGG - Intronic
1074570099 10:114616488-114616510 ATAGAAATTCACCAAGGAACTGG - Intronic
1075680372 10:124326890-124326912 GTAGACATTCAGTATTGGAAAGG - Intergenic
1077700241 11:4434661-4434683 CTAGACATTCACCATGGAGAGGG - Intergenic
1081374984 11:42347711-42347733 GCAGAGATTCACCATGCGAATGG + Intergenic
1087541917 11:99531893-99531915 GCAGAGATTCTCCATGAGAATGG - Intronic
1088074139 11:105825940-105825962 GATGGAATTCACCATGGAAAGGG - Intronic
1089557669 11:119323536-119323558 GTAGAAATTCAGCACGGTAGAGG + Intergenic
1090228973 11:125088289-125088311 ACAGAGATTCTCCATGGGAAGGG + Exonic
1090410544 11:126506003-126506025 TTTGAAATTCACTGTGGGAAAGG + Intronic
1090467937 11:126951914-126951936 GAAGCAATTGACCAAGGGAAAGG + Intronic
1090583013 11:128180675-128180697 GTGGAATTTCAGCATGGGAATGG - Intergenic
1090835858 11:130453015-130453037 CCAGGAATTCACCATGGGATGGG + Intronic
1093535966 12:20223586-20223608 GTAGTAAATCAGCATGGTAATGG + Intergenic
1093588694 12:20873078-20873100 TTCCAAATTCTCCATGGGAAGGG - Intronic
1095395897 12:41762015-41762037 GGAAAAATTTAACATGGGAATGG + Intergenic
1098456572 12:70681143-70681165 GTAGCAACTCAGCAAGGGAATGG + Intronic
1099121150 12:78690469-78690491 TTAGAAACTTACAATGGGAAAGG + Intergenic
1099521239 12:83666116-83666138 GTAGATTTTCCCCAAGGGAAAGG - Intergenic
1100082402 12:90869017-90869039 GTAGAAATTCAGCAAAGAAACGG - Intergenic
1100537019 12:95521044-95521066 GTGGTGATGCACCATGGGAAAGG - Exonic
1100679364 12:96901842-96901864 GTTGAAATGCACCATGGGCCAGG - Intergenic
1100859708 12:98791346-98791368 GAAAACATTCACAATGGGAAAGG + Intronic
1101920146 12:108925792-108925814 GAGGAAATTCATCATGGGGAGGG - Intronic
1102098489 12:110258954-110258976 GAAGAAATTCCCCCTGTGAACGG - Intergenic
1103477174 12:121227324-121227346 GGAGAAATTCACCAAAGAAATGG + Intronic
1107250687 13:38357796-38357818 GTGGAAGTGGACCATGGGAAAGG + Intronic
1107741428 13:43454423-43454445 ATTGAATTTCACCATGGGAGAGG + Intronic
1109045395 13:57405146-57405168 ATAAAAATTGACAATGGGAATGG - Intergenic
1109046353 13:57417051-57417073 GAAGAAATACATCCTGGGAATGG - Intergenic
1109595183 13:64543674-64543696 GCAGAAAGTCACCATGAGACAGG - Intergenic
1110021449 13:70478577-70478599 CCAGAACTTCACCATGTGAAAGG + Intergenic
1111909460 13:94294092-94294114 GTGGAAATTCCCCAAGGGAAGGG + Intronic
1114757779 14:25279915-25279937 GTAGAAATTTTGAATGGGAATGG - Intergenic
1115817446 14:37178307-37178329 GAAGAAATTAGCCATGGGAAGGG - Intergenic
1116202788 14:41820373-41820395 ATACAAATACACCATGGAAATGG - Intronic
1117481610 14:56151255-56151277 GTAAAAATTCACCAGGTAAATGG - Intronic
1118388776 14:65279585-65279607 GTAGTAATTCACCATGGTGTTGG - Intergenic
1119920425 14:78441175-78441197 CTAGAAATCAACCATGGTAAGGG - Intronic
1120339997 14:83207710-83207732 GCTGAAATTCACCATGGGATGGG + Intergenic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1120965590 14:90164945-90164967 GTATAAATTACCCATGGGTAAGG - Intronic
1129786715 15:78314559-78314581 GTAGAGATTCAGAAGGGGAATGG + Intergenic
1130156037 15:81350846-81350868 ATAGAAAATCACCAAGTGAACGG - Intronic
1131177829 15:90220987-90221009 GGAGAACTTCACCCTGGCAAGGG + Exonic
1133857105 16:9559792-9559814 GAAGAAATTCACCATGGGTTTGG - Intergenic
1134808863 16:17149947-17149969 ATAGAAATTCACCCTGATAAAGG - Intronic
1137065293 16:35834944-35834966 GTAGATTTTCACTAGGGGAAAGG + Intergenic
1140677673 16:77349343-77349365 TTAAAATTTCACCATGGCAATGG + Intronic
1140901446 16:79371654-79371676 GGAGGAACTAACCATGGGAAGGG - Intergenic
1143062362 17:4212688-4212710 GTAGAAAAAGACCATGGGAATGG + Intronic
1143294391 17:5859844-5859866 GCAGAAATGCACACTGGGAATGG - Intronic
1145043732 17:19596009-19596031 GCAGATGTGCACCATGGGAAGGG + Intergenic
1145775218 17:27522981-27523003 TTAGAAATACAGCATGGGGAGGG + Intronic
1146055720 17:29580036-29580058 GTAGAAATGCTGCATGGGAATGG - Intronic
1146478830 17:33185897-33185919 GGACAAATTCACCATAGGCAAGG + Intronic
1146958614 17:36953073-36953095 TGAGAAATTTACCAAGGGAATGG + Exonic
1151671844 17:75575239-75575261 GTAGAAATTTTCCATGTGAATGG + Intergenic
1156076622 18:33286921-33286943 GTAGACAATAAACATGGGAAAGG + Intronic
1156365874 18:36426464-36426486 GTGGAAAATCACCATGAGATTGG + Intronic
1157275216 18:46305389-46305411 GAGGAAATTTACAATGGGAAAGG + Intergenic
1158160088 18:54471588-54471610 TTTGAAATTAATCATGGGAATGG + Intergenic
1158414638 18:57238973-57238995 GCAGAAATTCATCATAAGAAAGG + Intergenic
1159004737 18:63002118-63002140 GTGGACATTCACCATGGGAGGGG + Intergenic
1159872468 18:73774102-73774124 GTAAAAATTCACCATCGGAGAGG - Intergenic
1160831375 19:1106251-1106273 GTGGAACTTCACCAAGGTAAGGG + Exonic
1161351769 19:3796941-3796963 ACAGAAATTAACCATGGGACAGG - Intronic
1162958629 19:14113506-14113528 CTAGAAACTCGCCCTGGGAATGG + Intronic
1164795707 19:31026121-31026143 TTAGAAATACACAAAGGGAAAGG - Intergenic
1165192143 19:34073739-34073761 TTAGAAAGTCACCATGTGAGGGG + Intergenic
1165984796 19:39758600-39758622 GTGGAAATTCATCCTGGGTAGGG + Intergenic
925064361 2:917654-917676 GTAGAAAGTCTTCATGGAAAAGG - Intergenic
925258180 2:2507479-2507501 ATGGGAAATCACCATGGGAACGG + Intergenic
926231753 2:11009781-11009803 GTTGAACTTCACCATAGAAATGG - Intergenic
926766165 2:16324625-16324647 CCAGAAATTAACCAGGGGAATGG + Intergenic
928320065 2:30276168-30276190 AGACAAATTCACCATGGCAAGGG - Intronic
928984722 2:37170043-37170065 GAAGAAAATGACTATGGGAAAGG - Intronic
930083529 2:47474791-47474813 ATAGCTATTCACAATGGGAAAGG + Intronic
930256418 2:49098457-49098479 ATAGAATTTGACCATGTGAAAGG + Intronic
931451659 2:62372289-62372311 GCAGAAATTCACAATGAGACAGG - Intergenic
931939191 2:67233307-67233329 GTAGAGATCACCCATGGGAATGG - Intergenic
931961761 2:67490443-67490465 CTAGAACTTGCCCATGGGAAAGG + Intergenic
932118288 2:69074288-69074310 GTAGAAACTCACTATGTGATGGG + Intronic
933699338 2:85243579-85243601 CTAGAAACTCAGCAAGGGAAGGG + Intronic
934959847 2:98662502-98662524 ATAGAATTTCAGAATGGGAAAGG - Intronic
935181997 2:100699915-100699937 TTAGAACTTCACCATACGAATGG - Intergenic
935265688 2:101391957-101391979 GTGAAAATTCACTATGGGGATGG - Intergenic
935607849 2:104988493-104988515 TTATATATTCACCATGTGAATGG - Intergenic
936242339 2:110798557-110798579 GTTGAAATGAGCCATGGGAAGGG + Intronic
936467076 2:112763430-112763452 GTAGAAAGTCACCATAGTATAGG - Intronic
937672704 2:124555856-124555878 CTACAAATTCCCAATGGGAAAGG - Intronic
940900592 2:159123235-159123257 GAAAAAAATCACCATCGGAAGGG - Intronic
941283566 2:163581784-163581806 GTAGAAATTAATCCTAGGAAAGG - Intergenic
941557691 2:167003253-167003275 GTAAAAATTCTTCAAGGGAAGGG - Intronic
941712742 2:168731585-168731607 GTATCATTTGACCATGGGAAGGG + Intronic
942487079 2:176451248-176451270 GTGAAAATTCACTTTGGGAAAGG + Intergenic
943139853 2:183968698-183968720 TTAGAAATTAACTCTGGGAATGG - Intergenic
946917288 2:224537017-224537039 TTAGAAATTCTCTATGGTAAAGG - Intronic
947361315 2:229348245-229348267 GTAGGAATTACCCATGTGAAGGG - Intergenic
947397564 2:229701670-229701692 GTAGATATTCTCCTGGGGAATGG - Intronic
947704143 2:232260860-232260882 GTAGGCATTCCCCATGGGGAAGG - Intronic
947782525 2:232781812-232781834 GTAGAAATAAACCATGGGTTAGG + Intronic
949067325 2:242000598-242000620 ATAGAAATTCACCGTGGAAGGGG - Intergenic
1168918840 20:1514145-1514167 GTAGAATGTCACAATAGGAAGGG + Intergenic
1171168556 20:22994760-22994782 GGAGAGAATCACCATGGGAGAGG - Intergenic
1176977681 21:15341148-15341170 GTTGAAATTAACTAGGGGAAAGG - Intergenic
1177634534 21:23770645-23770667 GCAGAAATTGAAAATGGGAAAGG - Intergenic
1178008792 21:28257920-28257942 ATAAAAATTAACCAAGGGAAAGG - Intergenic
1179245713 21:39632564-39632586 GTAGAAATTTACAAAGGAAATGG + Intronic
1181685511 22:24525189-24525211 GGAGTAATCCACCTTGGGAAAGG + Intronic
1183670779 22:39271229-39271251 GTTGTAAGTCACCATGTGAATGG - Intergenic
949939468 3:9143762-9143784 GTGGAGTTTCACCGTGGGAATGG - Intronic
950816026 3:15703362-15703384 TTGGAATTTCACCATGTGAATGG - Intronic
951441454 3:22728301-22728323 GTAGAAATTCATCATGTGACAGG + Intergenic
951486201 3:23213838-23213860 GTAAAAGATCATCATGGGAAAGG + Intronic
951712066 3:25593363-25593385 GAAGACATTCAACATGTGAAAGG + Intronic
952483577 3:33787148-33787170 GGAGAAATTCGCCATGGAGAGGG + Intergenic
955002482 3:54939940-54939962 CTAGAAATCCATCATGGAAAGGG - Intronic
958456412 3:94337184-94337206 ATAGAAATTCACCATCTAAAAGG - Intergenic
958558062 3:95705182-95705204 GGAGAAATTCACCAAAAGAAAGG - Intergenic
959892299 3:111570444-111570466 AGAGAAATTCACCATGATAATGG - Intronic
960701846 3:120447238-120447260 GTAGTAATTCCCAATGGGAGGGG + Intronic
961100663 3:124195920-124195942 GAAGAAATTCACAGAGGGAAAGG + Intronic
962385840 3:134931593-134931615 GCAGATCTTCACCATAGGAAAGG + Intronic
970311496 4:14787314-14787336 CTAGAATTTCTGCATGGGAAGGG - Intergenic
970556743 4:17241551-17241573 GTAGATATGAACTATGGGAAAGG - Intergenic
975662193 4:76699003-76699025 GTGGAAAGTCACCATGGGGAGGG - Intronic
976139393 4:81974795-81974817 ATAGAAATTAACAATGGGAAAGG - Intronic
978191440 4:105917301-105917323 GTAGAAATTCACCATGGGAATGG - Intronic
981552500 4:145956372-145956394 AGATAGATTCACCATGGGAAAGG - Intergenic
984179061 4:176458549-176458571 ATAGAAATACTCCAAGGGAATGG + Intergenic
986276027 5:6275797-6275819 GCAGAAATTCACCATGGCACTGG + Intergenic
986507410 5:8466686-8466708 TTAAAATTTCACCATGAGAATGG - Intergenic
987806696 5:22778328-22778350 AGAGAAATTCCCCATGGGAAAGG - Intronic
989049448 5:37304994-37305016 TTAGAAGTTCTCCATGGTAATGG - Intronic
990506263 5:56448429-56448451 GTAGGTATTCACCCTGGGCAGGG - Intergenic
991009527 5:61868417-61868439 GGAGAAGTTCATCATGGCAACGG + Intergenic
991040362 5:62169045-62169067 GGAGAAGTGCACCCTGGGAAAGG - Intergenic
992994585 5:82320090-82320112 ATAGATAGTCACCATGGGTATGG + Intronic
993307396 5:86289674-86289696 GGAGAAATGCAAAATGGGAAAGG - Intergenic
995396017 5:111687938-111687960 GAAGAAATTCGCCATGGATATGG + Intronic
997387127 5:133482535-133482557 GGAGAAGTGCACCATGGGCAAGG - Intronic
1002154207 5:177262804-177262826 GTTGAATTTCACCCTGGCAATGG + Intronic
1007371710 6:41430480-41430502 GGAAAAATACACCATGGGAATGG + Intergenic
1007469570 6:42079868-42079890 TTCCAAATTCACCAAGGGAATGG - Exonic
1008138645 6:47806438-47806460 GTAGAAATTGTACATGGGCAGGG + Intronic
1008253768 6:49272895-49272917 GTAAAAAGTTACCATGGGCAGGG - Intergenic
1010540705 6:77088515-77088537 GTAGAAAACAACAATGGGAATGG + Intergenic
1011182270 6:84634206-84634228 GTATTAAGTCACCTTGGGAATGG + Intergenic
1014567840 6:122972597-122972619 GTAGGAACTGACCAAGGGAATGG + Intergenic
1018344857 6:162890183-162890205 GTAGAAAGAACCCATGGGAAGGG - Intronic
1018968757 6:168510010-168510032 GTTGAAATTCACAACGGGAAAGG - Exonic
1021948721 7:25753707-25753729 GAAGAAATTCACACTGGGGATGG - Intergenic
1025192350 7:56905424-56905446 GTATAACTCCACAATGGGAAGGG - Intergenic
1025679599 7:63671507-63671529 GTATAACTCCACAATGGGAAGGG + Intergenic
1029234802 7:99106099-99106121 GTAGAATTTTACATTGGGAAGGG - Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030080745 7:105775668-105775690 GGAGAAACTGGCCATGGGAAGGG - Intronic
1031611378 7:123831896-123831918 GTAGAAAATTATCATGGAAAAGG + Intronic
1031856638 7:126930385-126930407 TTAGAAATTAACCAAGGGATCGG + Intronic
1033396806 7:140982388-140982410 TTTGAAATTCAACATGAGAAAGG + Intergenic
1034999647 7:155602830-155602852 GTAGGAATTCATCAAGGGGATGG + Intergenic
1037207593 8:16341770-16341792 CTAGAAATTCACCATAGAAGGGG - Intronic
1038074397 8:24055310-24055332 GTAGAACTTCATAATGGGGAAGG + Intergenic
1039894466 8:41706667-41706689 TCTGAAATTCACCATGGAAATGG - Intronic
1041879626 8:62734562-62734584 GAAGAAATTTACCATAAGAAAGG - Intronic
1042185701 8:66134698-66134720 GTGGAAATACACCATGGAAATGG + Intronic
1047695170 8:127396237-127396259 GTAAAATTTCATGATGGGAAAGG - Intergenic
1048420317 8:134271642-134271664 ACAGAAATCCACCATGGGACAGG - Intergenic
1053600059 9:39601773-39601795 GTAGAAAACCACCTAGGGAAGGG - Intergenic
1053857710 9:42355629-42355651 GTAGAAAACCACCTAGGGAAGGG - Intergenic
1054253466 9:62740611-62740633 GTAGAAAACCACCTAGGGAAGGG + Intergenic
1056221524 9:84454618-84454640 GGAGACATTCACCAGGGGTAGGG - Intergenic
1058951662 9:109909761-109909783 GTAGTAATTACCCATGGGAAGGG + Intronic
1059185636 9:112268142-112268164 GTAATAATTCACCATAGTAACGG + Exonic
1059484807 9:114618345-114618367 ATAGAAATTCATCAGGAGAAAGG - Intronic
1062693334 9:137857045-137857067 GTAGACATCCACCTTGGTAATGG + Intronic
1190787847 X:53670195-53670217 GTAGAAAGTCAACGTGAGAAAGG - Intronic
1191883471 X:65864891-65864913 GTAGAAAAACATCATAGGAAAGG - Intergenic
1193707114 X:84834740-84834762 GTGAAAATTAACCATGTGAAAGG + Intergenic
1194795343 X:98204811-98204833 GTAGCAACTCAGCATGAGAAAGG + Intergenic
1195835525 X:109110960-109110982 GTAGAAATGCTCCAAGGGAATGG - Intergenic
1197760736 X:130026099-130026121 TTAGAAATCCACTATAGGAATGG - Intronic
1198949892 X:142058441-142058463 GTAGACCTTCGTCATGGGAAGGG + Intergenic
1201427271 Y:13866218-13866240 CTTGAAAGTCACCAAGGGAAGGG - Intergenic