ID: 978197925

View in Genome Browser
Species Human (GRCh38)
Location 4:105991972-105991994
Sequence CAGGAGGACATGAAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 955
Summary {0: 1, 1: 1, 2: 8, 3: 84, 4: 861}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978197925_978197931 -5 Left 978197925 4:105991972-105991994 CCATCCTTCTTCATGTCCTCCTG 0: 1
1: 1
2: 8
3: 84
4: 861
Right 978197931 4:105991990-105992012 TCCTGGCTCATGGGCCCAAGAGG 0: 1
1: 0
2: 2
3: 15
4: 222
978197925_978197936 21 Left 978197925 4:105991972-105991994 CCATCCTTCTTCATGTCCTCCTG 0: 1
1: 1
2: 8
3: 84
4: 861
Right 978197936 4:105992016-105992038 CTCGTTATCTACTTTATCACAGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978197925 Original CRISPR CAGGAGGACATGAAGAAGGA TGG (reversed) Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
901329464 1:8394066-8394088 CAGAAAGACAAGATGAAGGATGG + Intronic
901463263 1:9404344-9404366 CAGGAGAACCGGGAGAAGGAAGG + Intergenic
901648224 1:10727987-10728009 CAGCAGCACGTGAAGAACGAGGG + Intronic
901700405 1:11042209-11042231 TAGAAGGATATGTAGAAGGATGG + Intronic
901971634 1:12913278-12913300 CAGGAGGGAATGAAAAAGAATGG - Intronic
902013533 1:13288462-13288484 CAGGAGGGAATGAAAAAGAATGG + Intergenic
902045599 1:13521674-13521696 GAGGAGATCATGAGGAAGGAGGG - Intergenic
902185150 1:14719462-14719484 CAGGAGGAAAAGAAGATGGGAGG + Intronic
902556635 1:17250678-17250700 AAGGAGGTAATGAGGAAGGAGGG + Intronic
902797119 1:18807177-18807199 CAGGAGCACAGGAGGAGGGAAGG + Intergenic
903226777 1:21898373-21898395 CAGGAGGACAGGGAGAGGGCAGG - Intronic
903635291 1:24809800-24809822 CAGGAAGGAAGGAAGAAGGAAGG + Intronic
903768399 1:25749232-25749254 CTGCAGGACAGAAAGAAGGAGGG - Intronic
903959213 1:27046213-27046235 AAGGAGGAGAAGAAGAAGGTGGG - Intergenic
904268034 1:29329082-29329104 CAGGAGCACAGGAAGATGAATGG + Intergenic
904301727 1:29558514-29558536 GGGGAGGAAATGAAGAGGGAGGG - Intergenic
904901556 1:33861768-33861790 CAGGAGGAGATAAAGAAAGGGGG + Intronic
904989230 1:34578148-34578170 CAGGAGCACTTGCAGAAGAAAGG - Intergenic
905266302 1:36756445-36756467 GAGGAGGACAGGAGGAAAGAGGG + Intergenic
905506867 1:38486658-38486680 CAGGAGGAAGGGAAGAAGGAAGG + Intergenic
905589132 1:39147028-39147050 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
905642418 1:39600205-39600227 AAGGAAGAAAGGAAGAAGGAAGG - Intergenic
905822856 1:41007238-41007260 CAGGAGGACAGGCTGAAGGACGG + Intronic
906180866 1:43817681-43817703 AAGAAGGAGAAGAAGAAGGAAGG - Intronic
906727508 1:48054795-48054817 CAGGAGGACATCGGGTAGGAGGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907797477 1:57732075-57732097 CAGGAGGGCATGCAGAATAAAGG + Intronic
908234255 1:62134912-62134934 CAGGAGGGGAGGAAGACGGATGG + Intronic
908432573 1:64073317-64073339 AAGGAGCACATGGAGCAGGAAGG - Intronic
908486132 1:64595578-64595600 CTGGGGCACATGAAGAAAGACGG - Intronic
908689109 1:66757157-66757179 AAGGAGGACATGAAGAGTAAAGG + Intronic
909059386 1:70862734-70862756 GAGGAGGAAAAGAAGAAAGAAGG + Intronic
910015327 1:82516919-82516941 AAGTAGAACATAAAGAAGGAAGG + Intergenic
910374431 1:86553114-86553136 CAAGAGGAGATGACGCAGGATGG - Intronic
910554604 1:88517477-88517499 GAGGAGGAGAAGAGGAAGGAAGG + Intergenic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
911636204 1:100238450-100238472 GAGGAGGAGAAGGAGAAGGAAGG - Intronic
911777544 1:101833458-101833480 CATGACGACATGAGTAAGGAAGG + Intronic
911858373 1:102912298-102912320 CATGTGGAAATGAAGAAAGAGGG - Intronic
912069557 1:105792708-105792730 TAGGAGGAGGTGAAAAAGGAAGG - Intergenic
912444659 1:109725970-109725992 CTTGAGGACATGAACAAAGAAGG + Intronic
912521711 1:110250273-110250295 CTGGAGGACATGGAGGAGGGAGG - Intronic
912673046 1:111649221-111649243 CAGGAGCACCTGGAGAAGAAGGG - Intronic
913099785 1:115552364-115552386 TAGGAGGACTTTAAGCAGGAGGG - Intergenic
913114436 1:115683676-115683698 CAGAAGGGCATGAAGAACGGTGG - Intronic
913161148 1:116147135-116147157 CAGAAGGAGCTGAAGAAGCAGGG - Intergenic
914716760 1:150260285-150260307 CAGGAGGAGATCCAGAAGGGAGG - Intronic
914801656 1:150966878-150966900 CAGGAGCCCATGATGATGGATGG - Intronic
915074853 1:153299582-153299604 CAGGAGGAGGAGAACAAGGAGGG - Intronic
915226703 1:154417079-154417101 CAGGAGGGCAGGGAGAGGGAGGG - Intronic
915359872 1:155279432-155279454 CAGGAGATCATGAAGCAGCAAGG - Intronic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
915672276 1:157499628-157499650 CAGTAGGTCCTGAAAAAGGAAGG - Intergenic
915948879 1:160174434-160174456 CAGGAGGAGTGGGAGAAGGACGG + Intronic
916045718 1:160998685-160998707 AGGGAGGGCATGAAGGAGGATGG + Exonic
916099564 1:161382712-161382734 GAGCAGGACATGAAGAGTGATGG + Intergenic
916348989 1:163827276-163827298 CAGGAGGAAATGAAGAAGGAGGG - Intergenic
916715511 1:167443735-167443757 CAGAAAGAAAGGAAGAAGGAAGG - Intronic
917019246 1:170568683-170568705 TAATAGGACTTGAAGAAGGAAGG - Intergenic
917039446 1:170788137-170788159 CAGGCCTACATGAAGATGGAGGG + Intergenic
917811012 1:178658459-178658481 TAGTAGGAGATGAAGATGGATGG - Intergenic
918301497 1:183208136-183208158 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
918431149 1:184462134-184462156 GAGGAAGACAGGAAGAAAGAAGG - Intronic
918503804 1:185228957-185228979 TAGGAGGAGATGAAGTAGGGAGG + Intronic
918876129 1:190046259-190046281 AAGGAGAAAAGGAAGAAGGAAGG + Intergenic
919348029 1:196411145-196411167 CAGAAGGAAAAAAAGAAGGAAGG - Intronic
919516949 1:198537407-198537429 AAGAAAGACAGGAAGAAGGAAGG - Intronic
919617007 1:199820410-199820432 AAGGAGGAAAGGAAGAAGGGAGG + Intergenic
919715444 1:200771009-200771031 CACAAGGACAGGAAAAAGGATGG - Intronic
919870837 1:201820054-201820076 GAGGAGGAGATGAAAGAGGAGGG + Exonic
920080574 1:203369836-203369858 CAGGAGGAAAAGAGGAAGCAGGG + Intergenic
920219203 1:204383941-204383963 CAGGAGGAGATGAGGATGGAGGG + Intergenic
920503652 1:206501298-206501320 GAGGGGGAGATGAAGAGGGATGG + Intergenic
920703243 1:208233546-208233568 CTGGAGGAAATGAAGAGGGCTGG - Intronic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920984651 1:210875024-210875046 AAGGAGGAAATGAAAAAGGAAGG + Intronic
921316625 1:213897863-213897885 CAGGAGGACATGTGGAAGCCTGG + Intergenic
921366531 1:214379752-214379774 CAGGAAGACTTGAAGTAGGGAGG - Intronic
922287465 1:224182976-224182998 CCGGAGAAGATGAAAAAGGAAGG - Intronic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
923250964 1:232179319-232179341 AAGGAAGAAAGGAAGAAGGAAGG + Intergenic
923311641 1:232741252-232741274 CAGGAGGATATGAAGAGCAAAGG - Intergenic
923425586 1:233865700-233865722 CTGGAGGGCTTGGAGAAGGATGG - Intergenic
923712014 1:236395453-236395475 AAGGAGGAGAAGAAGAAGGGAGG + Intronic
923978679 1:239295215-239295237 CAGAAAGACATAAAGTAGGAAGG - Intergenic
924173085 1:241361313-241361335 CAAGCAAACATGAAGAAGGAAGG + Intergenic
924654027 1:245956645-245956667 GAGGAGGAGAAGTAGAAGGAGGG - Intronic
1062815122 10:493706-493728 CAGGTGGACAGGAGAAAGGATGG + Intronic
1062826319 10:571442-571464 CAGGAGGAGAGGAAGAGAGAGGG - Intronic
1062922843 10:1293033-1293055 CAGGAAGAGATGCAGAGGGAGGG + Intronic
1062952635 10:1516189-1516211 CTGCAGGACACGAGGAAGGAAGG - Intronic
1063102741 10:2964553-2964575 CAGGACGTCTTGAAGCAGGAGGG - Intergenic
1063297177 10:4818178-4818200 CAGGAGGAAATAAAGGAAGAGGG + Intronic
1063297286 10:4819641-4819663 CAGCAGGAAATGAAGAAAGAGGG + Intronic
1063721558 10:8587202-8587224 AATGAGGAAGTGAAGAAGGAAGG - Intergenic
1065474774 10:26122711-26122733 AAGGAGGAGAAGGAGAAGGAGGG - Intronic
1065878264 10:30016328-30016350 AAGGAGGACAGGGTGAAGGAAGG + Exonic
1066106943 10:32164848-32164870 CAAGATGGGATGAAGAAGGATGG - Intergenic
1066106980 10:32165033-32165055 CAAGATGGGATGAAGAAGGATGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066449109 10:35511952-35511974 CAGTAGCACTTGAAGAAGAATGG + Intronic
1067196684 10:44125960-44125982 CTGGAGGAGATGGGGAAGGAGGG + Intergenic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067559989 10:47298478-47298500 GAGGGGCACATGGAGAAGGAGGG + Intergenic
1067808538 10:49409683-49409705 CAGGAGGGCAGGAAGGAGGAAGG - Intergenic
1067968496 10:50942045-50942067 TGGGAGGACCTGAAGAAGGAGGG - Intergenic
1068381928 10:56265409-56265431 CAGAAGGCCAAGAAGAAGCAAGG + Intergenic
1068478408 10:57558105-57558127 GAGGAGGAAAGAAAGAAGGAAGG + Intergenic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1068816719 10:61323626-61323648 GAGGAGGAAAGGAAGAAGGGTGG + Intergenic
1069557808 10:69408917-69408939 CTGCAGGCCATGAAGAAGGTGGG - Exonic
1069716876 10:70526742-70526764 GGGGAGGACAGGAAGATGGAGGG + Intronic
1070011029 10:72474738-72474760 AAGATGGAGATGAAGAAGGATGG - Intronic
1070189379 10:74097707-74097729 CAGGAAGAAATGAAGAATGGGGG + Intronic
1070699497 10:78589977-78589999 CAGGATGACATGAAGAGGTCTGG - Intergenic
1070742349 10:78911366-78911388 TAGGTGGGCATGAAGAAGGAGGG - Intergenic
1071438725 10:85670637-85670659 GAGCAGGAGATGAAGATGGAGGG - Intronic
1071716586 10:88102972-88102994 CATGAGGAAATGAAAAAGAAAGG + Intergenic
1071954560 10:90743671-90743693 CAGGAGGGCCTGCACAAGGAGGG - Exonic
1072222299 10:93336780-93336802 CAGGAGAAAAGGAAGAAGGAAGG + Intronic
1072309599 10:94141627-94141649 AAGGAGGAAAGAAAGAAGGAAGG + Intronic
1072426426 10:95334460-95334482 CAGGAGGGCAGGAGGAAGGGAGG + Intronic
1072662661 10:97372177-97372199 CAGGAGGACAAGGAGAGGGATGG + Intronic
1073021568 10:100448996-100449018 GAGGAGGAGAGAAAGAAGGAGGG + Intergenic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073101470 10:101008876-101008898 CAGGGTGACATGAGGAGGGAGGG - Intronic
1073106972 10:101037623-101037645 CAGGAGGAGAGGACAAAGGAAGG + Intronic
1074461350 10:113640338-113640360 CAGGAAGAAAAGAAGAAGAATGG + Intronic
1074532332 10:114305939-114305961 CAGGAGGAGATGCAGATGCAGGG + Intronic
1074691129 10:116005057-116005079 CAGGAGGAGAAGGAGATGGAGGG - Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1074835410 10:117287655-117287677 CAGGAGGATCTGAACAGGGAAGG - Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075289117 10:121213326-121213348 GTGGAGGAAATGAAAAAGGAAGG + Intergenic
1075962846 10:126584377-126584399 CAGGTGGACAGGTAGATGGATGG - Intronic
1076252356 10:128994617-128994639 CAGGAGGAAGGAAAGAAGGAGGG + Intergenic
1076276413 10:129203098-129203120 CACAAGGAGAGGAAGAAGGATGG + Intergenic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076558675 10:131346882-131346904 AAGGAGGGAAGGAAGAAGGAAGG - Intergenic
1076558688 10:131346929-131346951 AAGGAGGGAAGGAAGAAGGAAGG - Intergenic
1076664897 10:132081647-132081669 CAGGAGGACAAGAATAACGGAGG - Intergenic
1077223548 11:1427761-1427783 CAGGGGGAGATGATGAAGGGTGG + Intronic
1077433217 11:2526267-2526289 CAGGGGGAGATGAGGATGGATGG + Intronic
1077494966 11:2882582-2882604 CAGGAGGACATGGGGAGGGGTGG - Intergenic
1077626747 11:3779049-3779071 CCTGAGGAGATGGAGAAGGAGGG + Exonic
1077790990 11:5440013-5440035 CAGGATGGCAGGAAGAAAGAAGG - Intronic
1077893506 11:6436906-6436928 CAGAAGGGCATGCAGAAGGATGG + Intronic
1078766187 11:14300771-14300793 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
1079088648 11:17465083-17465105 CAGGAGGACATTAGGATGGAGGG + Intronic
1079339370 11:19599319-19599341 AAGGAAAACATGAAAAAGGATGG - Intronic
1079632268 11:22692514-22692536 CAGGAAGACACGAAGTAGGGAGG + Intronic
1080290335 11:30664055-30664077 GAGGTGGGCATGAAGTAGGAAGG - Intergenic
1080555962 11:33417751-33417773 CAGAAGGACAGAAGGAAGGAAGG - Intergenic
1080749310 11:35138363-35138385 CAGAAGGACATAAGGAAAGATGG + Intergenic
1080769923 11:35331177-35331199 CAGGAGGAAGTGAGGAAGGGAGG - Intronic
1081071826 11:38619776-38619798 GAGTAGCAGATGAAGAAGGAAGG - Intergenic
1081371443 11:42309377-42309399 CAGGAGCTCATGAGAAAGGATGG - Intergenic
1081778885 11:45696218-45696240 CAGGATGCCAGGAAGAAAGATGG - Intergenic
1082982226 11:59134163-59134185 CAGGTAGAAATGAAGAAAGAAGG - Intergenic
1083041005 11:59687416-59687438 AGGGAGGAAAGGAAGAAGGAAGG + Intergenic
1083498968 11:63085741-63085763 CAGGAGGTCATGACGATGAATGG + Intronic
1083629114 11:64086701-64086723 GAGAAGGGCATGAAGAAGGAAGG + Intronic
1084010582 11:66346385-66346407 AAGGAGGCAATGAAGCAGGAGGG - Intronic
1084702506 11:70796515-70796537 CTGGAGGACAGGGAGAAGGAAGG + Intronic
1084966969 11:72750097-72750119 CAGTAGGAAATGGGGAAGGAAGG - Intronic
1085350956 11:75797634-75797656 CAGGAGGTCAGGAAGGAGGGTGG + Intronic
1085420480 11:76354084-76354106 AAGGGGGACATGAACAAGGAGGG + Intronic
1085753938 11:79188512-79188534 GAGGAGGAGAGGAAGAAGGAGGG + Intronic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1085882942 11:80489287-80489309 CAGGAGGACGAGGAGAAGGGAGG + Intergenic
1086543010 11:87935060-87935082 CTGGAAGACAAGAAGAAGGGAGG - Intergenic
1086916320 11:92533755-92533777 TAGCAGGACATGAAGCAGCATGG - Intronic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087236996 11:95731267-95731289 CAGGAGGATAGAAAGCAGGATGG - Intergenic
1087760052 11:102096117-102096139 CAAGAGGACATGTAGAAGTAAGG + Intergenic
1088197677 11:107293864-107293886 AAGGAGGGCAAGAGGAAGGAGGG + Intergenic
1088677977 11:112214789-112214811 CAGGAGGACCTAGAAAAGGAAGG + Exonic
1088678904 11:112222331-112222353 CAGGAAGAGAAGAAGAAGAAAGG - Intronic
1088712948 11:112524776-112524798 CCTGAGGAACTGAAGAAGGAAGG - Intergenic
1088850644 11:113700522-113700544 TAGGAGGGAATGAAGAAGGGTGG - Intronic
1088970124 11:114766605-114766627 AAAGAGGACAAGAAGAATGAAGG - Intergenic
1088972735 11:114787911-114787933 CAGGAGGAAATGCAGAAAGCGGG - Intergenic
1088993171 11:114972276-114972298 AGGGAGGACATGAAAGAGGAAGG - Intergenic
1089461790 11:118658199-118658221 TAGGAGGGCATGAAGAGGCAGGG + Exonic
1089466168 11:118687943-118687965 TAGGAGGGCATGAAGAGGCAGGG + Intergenic
1089618461 11:119708796-119708818 AAGAGGCACATGAAGAAGGATGG + Intronic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1089997095 11:122918846-122918868 CAGGAAGGCAGGAAAAAGGACGG - Intronic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090031365 11:123209424-123209446 CAGGATGACAAGAAGAATTATGG + Intergenic
1090464474 11:126922058-126922080 TAGGAAGACAGGAAGATGGATGG - Intronic
1090556054 11:127877841-127877863 CAGGAGGAAATGGGGAAGGGAGG - Intergenic
1090990437 11:131812494-131812516 GAGGAGGAAAGGAAAAAGGAGGG - Intronic
1091173772 11:133541790-133541812 CAGGAGGACATGTTCAAGCAAGG + Intergenic
1091312544 11:134584976-134584998 AAGTAGGAAATGGAGAAGGAAGG - Intergenic
1091613270 12:2029897-2029919 TGTGAGGGCATGAAGAAGGAAGG + Intronic
1091689795 12:2588187-2588209 CGGGAGAACAAGAAGCAGGAAGG - Intronic
1092252222 12:6905863-6905885 ACGGAGGACATGATGAAGGAAGG + Exonic
1092254081 12:6916793-6916815 CAGGAGGAAGGGAAGAAAGAAGG + Intronic
1092440725 12:8499560-8499582 CAGGAGGACAGGACAAAGGAAGG + Intergenic
1092787150 12:12037314-12037336 CAGGAAGACAAGAGAAAGGAGGG + Intergenic
1093321048 12:17715923-17715945 CAGGAAGGCAGGAAGAAGGAAGG - Intergenic
1093619017 12:21265004-21265026 CAGGAGGACATGAGGAGAGGAGG + Exonic
1093698412 12:22189738-22189760 GAGGAGGACAAGGAAAAGGAAGG - Intronic
1093866072 12:24228877-24228899 CAGAATGCCATGGAGAAGGAAGG - Intergenic
1094234383 12:28146849-28146871 GAGGAGGAGAAGAAGAAAGAAGG - Intronic
1095264551 12:40138648-40138670 GAAGAGGGCATAAAGAAGGAAGG + Intergenic
1095299797 12:40571033-40571055 CAGGAGGAGTTGTAGTAGGATGG - Intergenic
1095708533 12:45263653-45263675 CAGGATTACATGAAGAATGGGGG + Intronic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1095820952 12:46478037-46478059 AAGGAGCACATCAAGAAGGAGGG - Intergenic
1096096467 12:48938772-48938794 TAGGTGGACAGGAAAAAGGAGGG + Exonic
1096399363 12:51292132-51292154 GAGGAGGAAATAGAGAAGGAAGG - Exonic
1096776176 12:53965727-53965749 CAGCAGGAGAAAAAGAAGGAAGG + Intergenic
1097087688 12:56480683-56480705 CAAGAGGAGAAGAAGAGGGAAGG - Intronic
1097147516 12:56951892-56951914 CAGGAGGTAATGAAGGAGGTGGG + Exonic
1097548458 12:61035406-61035428 GAGGAGCACCTGAAGATGGAGGG - Intergenic
1097694682 12:62764820-62764842 CGGGGGGCCATGGAGAAGGATGG + Intronic
1097840609 12:64318003-64318025 ATGGAAGTCATGAAGAAGGAGGG - Intronic
1098101413 12:67021288-67021310 TTGGGGGACAGGAAGAAGGAGGG - Intergenic
1098236145 12:68420198-68420220 CAAGAGGAGAGGAGGAAGGAGGG + Intergenic
1098656948 12:73044061-73044083 CAGGAGTTCATGGGGAAGGAGGG + Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099908357 12:88799158-88799180 AAGGAGGACATGAAGAAGGGAGG + Intergenic
1100263043 12:92950610-92950632 CAGGAAGGAAGGAAGAAGGAAGG + Intergenic
1100581051 12:95940903-95940925 CTGGAGGTCAAGAGGAAGGAAGG + Intronic
1100723143 12:97380039-97380061 GAGAGGGACAAGAAGAAGGATGG - Intergenic
1101652458 12:106689918-106689940 GAGGAGGAAATGAGAAAGGATGG + Intronic
1101659659 12:106754526-106754548 AATGAGGAAGTGAAGAAGGAGGG - Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102143470 12:110636257-110636279 CTGGAGGAAATGAAGATAGAAGG + Intronic
1102945164 12:116980249-116980271 CAGGAAGACATGCAGAACCAAGG - Intronic
1103410857 12:120710544-120710566 AAGGAGGAGAAGAAGAAGGCGGG + Exonic
1103444359 12:120984510-120984532 CAGGAGGACATGGCACAGGAGGG + Intronic
1103617299 12:122162449-122162471 CTGGAGGACAGGATGAAGGAAGG - Intergenic
1103662074 12:122528236-122528258 AGTGAGGAGATGAAGAAGGAGGG - Intronic
1103734567 12:123051181-123051203 CAGGAGGAAATGACCAAGGTTGG + Intronic
1103770121 12:123315926-123315948 CACAAGAACATGAAGATGGAGGG + Intronic
1104080447 12:125425606-125425628 CAGGAGTTCAGGGAGAAGGAGGG - Intronic
1104147010 12:126044322-126044344 CAGGATGAAGTCAAGAAGGAAGG + Intergenic
1104515864 12:129426157-129426179 CAGCAGGACATGAAGAGAGAAGG - Intronic
1104616356 12:130273306-130273328 GAGGAGGAGAGGAAGGAGGAGGG - Intergenic
1104876537 12:132038838-132038860 CAGGGCCACATGAAGGAGGAGGG - Intronic
1104892786 12:132148461-132148483 AATGGGGACAGGAAGAAGGAAGG + Intronic
1104947355 12:132422044-132422066 CAGGAGGACAGTGAGAAGGAGGG + Intergenic
1105544856 13:21343963-21343985 AGGGAGGAGATGGAGAAGGAGGG - Intergenic
1105828345 13:24142705-24142727 AAGGAGGAGAAGAAGAAGGGAGG - Intronic
1107084230 13:36408187-36408209 AAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1107291312 13:38857474-38857496 CTGGAGGACATTCTGAAGGAAGG - Intronic
1107333098 13:39322759-39322781 AAGGAGGAAGGGAAGAAGGAGGG + Intergenic
1107357526 13:39583853-39583875 CCGGAGGACACGAGGGAGGATGG - Intronic
1107650335 13:42538502-42538524 CAGAAGGGGAGGAAGAAGGAAGG + Intergenic
1109048998 13:57453606-57453628 CAGGATGACCTGAAGAAATATGG - Intergenic
1109214868 13:59578379-59578401 TAGGAGGAGATGAAAAAGAAAGG + Intergenic
1109535874 13:63718739-63718761 CTGGAGGAAGTGAAGAAAGAGGG + Intergenic
1109540227 13:63767547-63767569 CTGGAGGAAGTGAAGAAAGAGGG - Intergenic
1109714732 13:66206487-66206509 CAGCAGTACATGACAAAGGATGG - Intergenic
1109807545 13:67463793-67463815 CAGGAAATCATGAAAAAGGATGG - Intergenic
1110239765 13:73254190-73254212 CAGGAAGAAAGAAAGAAGGAGGG + Intergenic
1110726240 13:78827754-78827776 CAGCCGAACATGAATAAGGAAGG + Intergenic
1110865991 13:80397102-80397124 AAGGAGAACAAGAAGAAAGAAGG + Intergenic
1111259904 13:85724171-85724193 CATGAGGACATGAAAAAGAGGGG - Intergenic
1111999470 13:95196571-95196593 AAGGAGGAAAGGAGGAAGGAAGG + Intronic
1112111793 13:96308653-96308675 CAGGAAGAAAGGAATAAGGATGG - Intronic
1112389828 13:98972845-98972867 CAGCAAGGCATGAGGAAGGAAGG - Intronic
1112422710 13:99267551-99267573 CAGGAGGATATAAGTAAGGAAGG + Intronic
1113095758 13:106662319-106662341 GAGGAGGACATGAAGAAAGGTGG + Intergenic
1113813790 13:113158248-113158270 CAGGAGGATGGAAAGAAGGAAGG - Intergenic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114531660 14:23400320-23400342 CAGGAGGAGTACAAGAAGGAGGG - Exonic
1114536878 14:23428564-23428586 CAGGAGGAGTACAAGAAGGAGGG - Exonic
1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115662708 14:35512728-35512750 CAGGAGCACCTGCAGAAGAAGGG - Intergenic
1115915675 14:38310588-38310610 AAGGAGGAAATGAAGAAGAATGG - Intergenic
1116537153 14:46046974-46046996 GAGGGTGAAATGAAGAAGGAGGG - Intergenic
1117076823 14:52113663-52113685 AAGGAAGAAAGGAAGAAGGAAGG + Intergenic
1117087349 14:52215209-52215231 AAGGAGGAAAGAAAGAAGGAGGG + Intergenic
1117592583 14:57288120-57288142 AAGAAGGGCATGAAGAAGAAAGG + Intronic
1117736573 14:58774309-58774331 AAGGAGGAAATGAGGGAGGAAGG - Intergenic
1118233790 14:63980495-63980517 TAGGAAAACAGGAAGAAGGATGG - Intronic
1118427027 14:65676606-65676628 AAGGAGGGAAGGAAGAAGGAAGG - Intronic
1118443131 14:65829670-65829692 CAGGAGGACAGGAATGGGGAGGG + Intergenic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1118772153 14:68949311-68949333 GAGGAGGTCAGGAGGAAGGAAGG + Intronic
1119113777 14:71999481-71999503 CAGGTGGAGATGGAGAAGGGAGG + Intronic
1119658212 14:76432456-76432478 CAGGAGGACTAGGAGAAGGAGGG - Intronic
1119711360 14:76824878-76824900 CAGGAGGTCAGGATGAAGGAAGG - Intronic
1119977845 14:79045231-79045253 CAGTAGGAGATGAAGAAGGAGGG - Intronic
1120583930 14:86287424-86287446 AAGGAGGAAGTGAGGAAGGAAGG + Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121493734 14:94378050-94378072 CAGGGGGACATGAAGATGCTTGG + Exonic
1121701541 14:95958365-95958387 CAGGAAGACTAGAAGAAGGGAGG - Intergenic
1121918473 14:97857869-97857891 CAGGAGGAGATGAAGCTGGCAGG + Intergenic
1121950843 14:98169946-98169968 CAGAAGGACAAGCAAAAGGATGG + Intergenic
1122848014 14:104511273-104511295 CGGGAGGACATGGACAGGGAAGG - Intronic
1122946283 14:105011700-105011722 CAAGAGGAGATGACGCAGGATGG - Exonic
1122977837 14:105178255-105178277 CAGGAGCAGATGAGGAAGGGTGG + Intronic
1123007889 14:105333200-105333222 CAGGAGCACATGCAGCAGGAGGG - Intronic
1123625375 15:22223472-22223494 CAGGAGGCCGAGCAGAAGGAGGG - Intergenic
1124961510 15:34400157-34400179 AAAGAGGACATGACGAGGGAGGG + Intronic
1124971748 15:34495796-34495818 AAGGAGGCCATCAAGATGGACGG + Intergenic
1124978136 15:34546380-34546402 AAAGAGGACATGACGAGGGAGGG + Intronic
1125239288 15:37554916-37554938 CAGGAGGAAATGAAGAACATTGG + Intergenic
1125246273 15:37644782-37644804 CAGGAAAGCATGGAGAAGGAAGG + Intergenic
1125826091 15:42677843-42677865 CAGGAGGACAAGAAAGAGAAAGG - Intronic
1125894176 15:43288061-43288083 CTGGAGGACTTGAAGAAGCAGGG + Intronic
1126711853 15:51467179-51467201 CAGGAGGAAACAGAGAAGGAAGG + Intronic
1126898168 15:53282647-53282669 CAAGATGGCAGGAAGAAGGATGG + Intergenic
1127122110 15:55780612-55780634 AAGAAGGACAGGAAGGAGGAGGG + Intergenic
1127591065 15:60424105-60424127 CTGAAGGACAAGAAAAAGGAAGG + Intronic
1127634194 15:60853536-60853558 CAAGAAGACATCAAAAAGGAAGG + Intronic
1127760591 15:62135811-62135833 GAGGAGGCAATGAAGAAGAAAGG - Intergenic
1128082008 15:64862318-64862340 CTGGAGGGGATGAAGAGGGAGGG + Intronic
1128466242 15:67914965-67914987 GAGGAGGAAAAGAATAAGGAGGG - Intergenic
1128507084 15:68280584-68280606 TAGTAGGACATGAAGAAGAGGGG + Intronic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128796390 15:70469732-70469754 GGGGAGGACAGGAAGAAGCAGGG + Intergenic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129712928 15:77830180-77830202 CTGGAAGTCAAGAAGAAGGAAGG + Intergenic
1129921917 15:79326603-79326625 GAGGAGGGCGGGAAGAAGGAAGG + Intronic
1130123195 15:81069964-81069986 CAGGAGGACAAGAATGAGGGCGG + Intronic
1130969351 15:88720051-88720073 CAGAAGGAAAAAAAGAAGGAAGG - Intergenic
1131476933 15:92747684-92747706 CAGGAGAGCAGGAAGAAGCAGGG + Intronic
1131727180 15:95239414-95239436 CAGGAGGGGGAGAAGAAGGAAGG + Intergenic
1131909947 15:97187306-97187328 CCGGAGGAGATGAAGAGAGATGG + Intergenic
1132113545 15:99119466-99119488 CTGGAAGACAAGATGAAGGATGG + Intronic
1132140092 15:99385163-99385185 CTGAAGGGCAGGAAGAAGGAAGG - Intronic
1132529624 16:439785-439807 CAGGAAGACATGAAGCAGGGAGG + Intronic
1132833636 16:1941941-1941963 CAGGAGCCCAGGAAGAAAGAGGG + Intronic
1133130912 16:3675708-3675730 CAGCAGGACACAAAGAGGGAAGG + Intronic
1133729783 16:8569443-8569465 GAGGAGGAAATGAAGTCGGAGGG + Intergenic
1133784308 16:8963206-8963228 CCCGAGGACATGGAGATGGAAGG - Exonic
1134250654 16:12571564-12571586 CAGCAGGCCATGAAGACAGAAGG - Exonic
1134692028 16:16197449-16197471 AAGGAGGAGAGGAAGAAGAAAGG + Intronic
1135176697 16:20236235-20236257 GTGGAGGACATGAAGGAGGTGGG - Intergenic
1135628962 16:24021242-24021264 AAGGAAGAAAGGAAGAAGGAAGG - Intronic
1135640226 16:24113465-24113487 AAGGAAGAAAGGAAGAAGGAAGG - Intronic
1135771001 16:25218321-25218343 CAAGAGGTGATCAAGAAGGAGGG + Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135942448 16:26834304-26834326 GAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1136040521 16:27575288-27575310 CAGAGAGACATGAATAAGGAAGG + Intronic
1136075192 16:27812313-27812335 CAGGAGGATATGAAGAGGGTTGG + Intronic
1136237985 16:28925967-28925989 CAGGAGGACACGTAGAATCAAGG - Intronic
1136480046 16:30535438-30535460 CAGGAAGACGTGAAGCAGGAAGG + Intronic
1136600929 16:31287905-31287927 CAGGACCACATGAGGAAGGCTGG + Intronic
1136901112 16:34038836-34038858 TAAGAGGAAAGGAAGAAGGAAGG + Intergenic
1137916761 16:52440066-52440088 CAGGAGGGCATGAATAATGGTGG - Intronic
1137926798 16:52547567-52547589 CAGGCACCCATGAAGAAGGAAGG - Intronic
1137937899 16:52652257-52652279 AATAAGGACATGAAGAAGGGAGG + Intergenic
1138231509 16:55340348-55340370 AATGAGGACATGAGGATGGATGG + Intergenic
1138271409 16:55698518-55698540 CATGAGGACAGCAAAAAGGATGG - Exonic
1138347551 16:56329329-56329351 CAGGAGGGCAGGAGGACGGAAGG + Intronic
1138597387 16:58036259-58036281 CTTGAGGACATGAAGCAGGCAGG + Intronic
1138906287 16:61339084-61339106 GAGGAGAAAATGAAGAAGAAGGG + Intergenic
1139303970 16:65967721-65967743 GAGGAGGCCAGGAAGAAGCAGGG - Intergenic
1140771252 16:78205892-78205914 AAGGAAGACAGGAGGAAGGAAGG - Intronic
1140831052 16:78751756-78751778 AAGGAGGAAGGGAAGAAGGAGGG + Intronic
1140958048 16:79885696-79885718 CAGGAAGTGATGGAGAAGGACGG - Intergenic
1141359384 16:83381318-83381340 CAGGAAGACATGAAGGGGCAGGG - Intronic
1141533409 16:84662077-84662099 CCAGAGGACAAGAAGAAGAAAGG + Exonic
1141756249 16:85993025-85993047 CAGAAGGACAGAAAGGAGGAAGG - Intergenic
1141833402 16:86522392-86522414 CAGGAGGACAGGAAGAGGGGAGG + Intergenic
1142056807 16:88002863-88002885 CATGAGCAACTGAAGAAGGACGG - Intronic
1142129247 16:88425283-88425305 CAGGAGGTGATGGAGGAGGAGGG - Intergenic
1142246674 16:88973362-88973384 CAGCAGGACCTGGAGAAGGCAGG + Intronic
1142328781 16:89436592-89436614 CAGGCGGAAATGAAGACGCAGGG + Intronic
1142438591 16:90078520-90078542 CAGGAGGACTTGCAGAACGGAGG + Intronic
1143929828 17:10410841-10410863 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143938213 17:10509549-10509571 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143940663 17:10537729-10537751 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143952281 17:10642890-10642912 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1144052118 17:11505861-11505883 CAAGAGGAAATGGAGAAGAAAGG + Intronic
1144184628 17:12785481-12785503 GAGGAGGAGGTGAGGAAGGACGG - Intergenic
1144288303 17:13800871-13800893 CAGCAGTACATGAAAAAGGGTGG - Intergenic
1144754664 17:17671810-17671832 CAGGACAACCTGAAGAAGGTGGG + Intergenic
1145871452 17:28276985-28277007 CAGGAGCACCTGGAGAAGAAGGG - Intergenic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1145986008 17:29046745-29046767 CAGGAGGACAGGAATTTGGACGG + Intronic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1146787148 17:35730596-35730618 CAGGAGCCCATGAGGAAGCATGG - Intronic
1147926059 17:43946577-43946599 CGGGAGGTGATGAAGAAGCAAGG + Intergenic
1148215901 17:45833918-45833940 CAGGAGGCCAGGGAGAAGCAAGG + Intronic
1148467526 17:47873831-47873853 GAGGAGGAAAGCAAGAAGGAAGG - Intergenic
1148686449 17:49503715-49503737 CAGGTGGCCATGAAGCAAGACGG - Intronic
1148716955 17:49722767-49722789 CTGGAGGACATGAACTGGGAAGG - Intronic
1149814222 17:59707255-59707277 AAGGAGAAAATGAAGAAGGTGGG + Intronic
1149936313 17:60810502-60810524 CAGGAGCACCTGGAGAAGAAGGG + Intronic
1150067373 17:62122915-62122937 AAGGAAGAAAGGAAGAAGGAAGG + Intergenic
1150466826 17:65400683-65400705 AAGGAAGGCAGGAAGAAGGAAGG - Intergenic
1151084905 17:71368984-71369006 CAGGATGACAAGAAGAAGACAGG + Intergenic
1151934739 17:77254871-77254893 CAGGAGGAAATAGAGTAGGATGG - Intergenic
1152234922 17:79133626-79133648 CAGCAGGACTTGAGCAAGGATGG - Intronic
1152296251 17:79468805-79468827 CAGGAAGACAGGCAGGAGGATGG + Intronic
1153006829 18:504533-504555 CTGGAGGATATGAAGACGGAAGG + Intergenic
1153446863 18:5182831-5182853 CAGGAGTACATGAAGAATCTAGG + Intronic
1153953430 18:10076241-10076263 CAGGAGGTCATGAGGAAAGGAGG - Intergenic
1154155028 18:11937276-11937298 GAAGAGGAGAAGAAGAAGGAGGG + Intergenic
1154334082 18:13452207-13452229 CAGCAGGAGATGAATAGGGAGGG + Intronic
1154384944 18:13884796-13884818 CAAGAGGACATGAAGCACAAAGG + Exonic
1155512674 18:26593580-26593602 CAGGAGGAGAAGGACAAGGAGGG + Intronic
1155512710 18:26593755-26593777 CAGGAGGAGAAGGACAAGGAGGG + Intronic
1155512723 18:26593813-26593835 CAGGAGGAGAAGGACAAGGAGGG + Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156148124 18:34211086-34211108 AAGGAGGGAAGGAAGAAGGAAGG + Intronic
1156295446 18:35785341-35785363 CCTGAGGAAATGAGGAAGGATGG - Intergenic
1156310590 18:35918584-35918606 CAGGGAGGCATGCAGAAGGATGG + Intergenic
1156674614 18:39512768-39512790 CATGAGGAGAAGGAGAAGGATGG - Intergenic
1156753761 18:40494865-40494887 GATGAGGAAAGGAAGAAGGAAGG + Intergenic
1156822702 18:41391952-41391974 AAGAGGGACATGAAGAAGAAAGG + Intergenic
1156965093 18:43081893-43081915 CAGGAAGGAAGGAAGAAGGATGG - Intronic
1157047617 18:44121735-44121757 GTGGAAGACATGAAGAAAGATGG + Intergenic
1157112279 18:44832647-44832669 CAGGAAGAGATGAGGAAGGCTGG - Intronic
1157492605 18:48135007-48135029 GAGGAGGAGAGGGAGAAGGAAGG - Intronic
1157612720 18:48968453-48968475 AGGGAGGAAATGAGGAAGGAAGG + Intergenic
1158229223 18:55234750-55234772 CAAGAGGACCTGATGAAGGCTGG + Intronic
1158262883 18:55628237-55628259 CTGGATGACATTAAGAAGGAAGG + Intronic
1158458518 18:57628042-57628064 CAGGAAGACTTGAAGCAGGGAGG + Intergenic
1158568959 18:58580368-58580390 CAGGGACACATGAAGAAGAAAGG - Exonic
1158684960 18:59605172-59605194 CAGGGAGAAATGGAGAAGGAAGG + Intronic
1158866514 18:61642998-61643020 CATGGGGACATAAAGAAGCAAGG - Intergenic
1159018936 18:63127337-63127359 CAGAAGGACATGGTGAAGGCTGG - Exonic
1159740367 18:72160538-72160560 CAGGAGAAAATGAAGAAAAAAGG - Intergenic
1159826896 18:73224009-73224031 CTGGGGGACAGGAAGAGGGAGGG + Intronic
1160431428 18:78815660-78815682 CAGGAGGACAAGAACAAGGAAGG + Intergenic
1160754880 19:751856-751878 AAGGAGGCCATGCAGAAGGGAGG - Intronic
1161000711 19:1909431-1909453 CAGGTGGACATGAGGCAGTAGGG - Intronic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1161783051 19:6306451-6306473 GAGGAGGAAATGAAAGAGGATGG + Exonic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162269685 19:9604012-9604034 AAGGAGGAAAGAAAGAAGGAAGG + Intergenic
1163197694 19:15735216-15735238 CAGAAGGAGAAGGAGAAGGAGGG - Intergenic
1163198682 19:15746053-15746075 GAGGAGGACGTGGAGGAGGAAGG - Intergenic
1163425851 19:17240670-17240692 CGGGTGGGCATGAGGAAGGAGGG - Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163861313 19:19744378-19744400 CTGGAGGTCATGAAGATGAAGGG + Intergenic
1164042357 19:21504980-21505002 CAGGAAGACACGAAGCTGGAGGG + Intronic
1164468420 19:28507772-28507794 CAGGAAGGCATAAAAAAGGAGGG + Intergenic
1164612455 19:29641840-29641862 GAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1164717430 19:30403785-30403807 CAAGAGCACAGGAAGAACGAGGG - Intronic
1165138094 19:33683490-33683512 CAGGAGGCAAGGAAGAAGCAAGG - Intronic
1165308656 19:35017696-35017718 AAGGAGGAACTGAGGAAGGAAGG - Intronic
1165905796 19:39193949-39193971 GAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1165910280 19:39221782-39221804 AAGGAGGGAAGGAAGAAGGAAGG - Intergenic
1166312374 19:41970009-41970031 GAGGAGGAGGTGGAGAAGGATGG + Intronic
1166544781 19:43627471-43627493 CAGGAGGACTTGAATAATGCTGG - Intronic
1166868871 19:45858449-45858471 CTGAAGGAAATGAAGAGGGAAGG - Intronic
1166959362 19:46488492-46488514 GAGGAGGGCAGGATGAAGGAGGG - Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167507463 19:49878339-49878361 CAGTGGGACCTGAAGAAGGCTGG + Intronic
1167609892 19:50501936-50501958 GAGGAGGTGATGAAGGAGGAGGG - Intergenic
1167619226 19:50551873-50551895 CAGAAGGAGAGAAAGAAGGAGGG - Intronic
1167883420 19:52481261-52481283 TAGGAGGACATGAAGGAAGAAGG - Intronic
1167891410 19:52542737-52542759 CAGGAAGACTTGAAGCAGGGAGG + Intronic
1168357411 19:55710625-55710647 CAGGAGGAAAGGAAGCAGGGGGG - Intronic
925443853 2:3910640-3910662 CAGGTGGGCATGAGGAAGGGTGG - Intergenic
925882947 2:8368251-8368273 AAGGAGGGCACGGAGAAGGAAGG + Intergenic
925971133 2:9107425-9107447 CCTCAGGACAGGAAGAAGGATGG + Intergenic
926135198 2:10331354-10331376 CAGGAGGAAACGCAGGAGGAGGG - Intronic
926137440 2:10346787-10346809 CACAAAGACATGGAGAAGGAAGG - Intronic
926234234 2:11027418-11027440 GAAGGGGACGTGAAGAAGGAGGG - Intergenic
926352595 2:12010339-12010361 CAGGAAGTCATACAGAAGGAAGG + Intergenic
926763958 2:16306023-16306045 CAGAAGGACAAGAGGAAGAAGGG - Intergenic
927300085 2:21502053-21502075 CAGTGAGACATGAAAAAGGAAGG + Intergenic
927384775 2:22520572-22520594 TAGGAGGAGATGAGGAGGGAGGG - Intergenic
927437057 2:23075774-23075796 CAGTGAGACATGAAGAAAGAGGG - Intergenic
927445533 2:23157794-23157816 CAGGGAGACACGAAGAAAGAGGG - Intergenic
927503348 2:23596792-23596814 CAGGAGGACATAAATAAATAAGG + Intronic
927887806 2:26729151-26729173 AAGCAGGACAGAAAGAAGGAGGG + Exonic
927990700 2:27444985-27445007 GAGGAGGACTTGGAGAATGAAGG - Intronic
928324320 2:30307600-30307622 CCAGAGGACATGGAGAAGCATGG + Intronic
928436746 2:31259443-31259465 CAGTAGGAGCTGAAGTAGGAGGG - Intronic
928568719 2:32581179-32581201 CAGGAAGACATGAACATGTATGG - Intronic
928858087 2:35824216-35824238 CAGGAAGACTTGAAGCAGGGAGG + Intergenic
928891874 2:36213631-36213653 GAGGAGGAGAAGAAGATGGAAGG - Intergenic
929080031 2:38113276-38113298 CAGCAGGGCAAGAAGAGGGAAGG - Intergenic
929173216 2:38952450-38952472 CTGGATGACATGAAGTGGGATGG + Intronic
929794079 2:45045435-45045457 AGGGAGGAGAGGAAGAAGGAAGG - Intergenic
929892622 2:45930981-45931003 CAGGAGGAAATGAAGGATCAGGG - Intronic
930061961 2:47297277-47297299 CAGGAAGGCATGAAGAAGTGGGG + Intergenic
930458168 2:51633208-51633230 CAGGTAGCCAAGAAGAAGGAAGG - Intergenic
930773251 2:55148866-55148888 CAGGAAGGCATGAAAACGGAAGG + Intergenic
930903956 2:56543323-56543345 CAAGAGGACATGAAGAGTGCTGG + Intergenic
931066138 2:58589327-58589349 CATGAGGATAAGAACAAGGAGGG + Intergenic
932714405 2:74090843-74090865 CAGGAGCCCAGGCAGAAGGAAGG - Intronic
932823436 2:74920470-74920492 CAGGAGCCCATGACGAAGGCCGG + Intergenic
933481374 2:82861217-82861239 GAGGAGGAGAAAAAGAAGGAAGG - Intergenic
933645320 2:84807922-84807944 AAGGAGGACTGGAAAAAGGAAGG - Intronic
933881400 2:86673570-86673592 GAGGAGGGCCTGAAGAAGCAGGG - Intronic
935278493 2:101496653-101496675 CAAGATAACATCAAGAAGGAAGG + Intergenic
935331305 2:101979721-101979743 GAGGAGGTCCTGAAGAAGGTCGG + Intergenic
936397927 2:112143155-112143177 CAGGTGGTCATGGGGAAGGAAGG + Intronic
936572976 2:113631681-113631703 CTGGAAGACAGGATGAAGGAGGG - Intronic
936717319 2:115203091-115203113 AAGGAAGAGATGAATAAGGAAGG + Intronic
937241524 2:120465354-120465376 CATGAGGACAGGATGGAGGAGGG - Intergenic
937264200 2:120605883-120605905 CAGGAGGACACGGAAATGGAAGG + Intergenic
937346486 2:121129356-121129378 CAGGAGGGCTTGAAGAATCATGG - Intergenic
937677071 2:124603050-124603072 AAGGAAGAAAAGAAGAAGGAAGG - Intronic
938299838 2:130202422-130202444 AAGGAGGACATGCACAAGGTAGG + Intergenic
938456872 2:131472063-131472085 AAGGAGGACATGCACAAGGTAGG - Intronic
939581178 2:143947851-143947873 CAGGAGGAGGTGAAGAAGGAAGG + Intronic
939865313 2:147465981-147466003 CAGGGTGACTTTAAGAAGGAAGG - Intergenic
940133389 2:150409364-150409386 CAGGAGGGCAAGCACAAGGAAGG - Intergenic
940312847 2:152296586-152296608 CATGAGGAAATGAAGAAAGTAGG + Intergenic
940638761 2:156327639-156327661 CATGAGGACAGGATGGAGGAAGG - Intronic
941179990 2:162247946-162247968 TAGGAGGAGTTGAAGATGGAAGG + Intergenic
941227925 2:162871350-162871372 AAGGAAGACAGGAAGAAAGAAGG + Intergenic
941695617 2:168548190-168548212 CATGAAGTTATGAAGAAGGAGGG + Intronic
941714486 2:168749416-168749438 CAGGAGGCCAGGGAAAAGGAGGG - Intronic
941840270 2:170075337-170075359 CAGGATGACATGGAGTAAGAGGG + Intronic
942629404 2:177939405-177939427 AAGGAGGGAAGGAAGAAGGAAGG + Intronic
943188147 2:184640246-184640268 GAGGAGGAGAAGAAGAAGAAAGG + Intronic
943232207 2:185268719-185268741 TAGGAGGAAGTGAGGAAGGATGG - Intergenic
943703234 2:191009053-191009075 CAGGAGGTCATGAAAACGGATGG + Exonic
943787536 2:191895255-191895277 CAGAAGGAAAAGACGAAGGAAGG + Intergenic
944161014 2:196659975-196659997 GGGGAAGACATGAGGAAGGATGG - Intronic
944166841 2:196731748-196731770 CAGGAGAAAATTAAGAATGAAGG - Intronic
944867933 2:203880675-203880697 CAGAAGCACATGACGAAAGAGGG + Intergenic
945920908 2:215753766-215753788 GTGGAGGACATGAAGGAGGCAGG + Intergenic
946026560 2:216675199-216675221 CAGGAGAACAGTAAGATGGATGG - Exonic
946113213 2:217438231-217438253 CAGGAGGACAGAAAGAACCAGGG - Intronic
946128067 2:217581778-217581800 CAGGGAGGCATGAAGAATGAAGG + Intronic
946142777 2:217705875-217705897 CAGAGGGACATCTAGAAGGATGG + Intronic
946190385 2:218004738-218004760 CTGGAGGACTTGGAGAAGTATGG - Intergenic
946481560 2:220061708-220061730 CGGGTGGCCATGAACAAGGAAGG + Intergenic
946823909 2:223657048-223657070 GGGGAGGACATGGAGAGGGAAGG - Intergenic
946973620 2:225123138-225123160 AAGGAGGAAAGGAGGAAGGAAGG - Intergenic
947152335 2:227128622-227128644 GAGAAGGACATGGAGAATGAGGG - Intronic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
948424248 2:237877529-237877551 CAGGTGGACGTGAAGAGTGACGG + Intronic
948619210 2:239223444-239223466 CAGGTGGAAATGCAGAAGGCAGG + Intronic
1169253089 20:4075127-4075149 CTGGAGGAGATGAGGATGGAGGG - Exonic
1169280015 20:4259061-4259083 CAGGAGGAGGTGCAGAGGGATGG + Intergenic
1169316293 20:4593309-4593331 CAGGGGCACAGGAAGAAGGAGGG - Intergenic
1169793678 20:9438617-9438639 CAGGTGGAGAAGAAGAAGGAGGG + Intronic
1170000763 20:11610830-11610852 AAGGAGGAAATTAAAAAGGAAGG - Intergenic
1170113176 20:12827464-12827486 CAGAAGGAAAAAAAGAAGGAAGG + Intergenic
1170223444 20:13965110-13965132 CAGGAGGTCAGGAAGTAGGAAGG + Intronic
1170372571 20:15665503-15665525 CAAGAGGACCTGGAGAAGCAGGG + Intronic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170713884 20:18815919-18815941 CATGGGGAAATGAGGAAGGATGG + Intronic
1170758089 20:19222746-19222768 GAGGAGGGAAGGAAGAAGGAGGG - Intronic
1170858716 20:20082573-20082595 CAGGAGGACTTGAAAAAGACAGG - Intronic
1170941864 20:20854645-20854667 CAGGAGGAAAAGATTAAGGAGGG + Intergenic
1171049301 20:21840441-21840463 CAGGAGGAGAGGGAGAAGAAAGG - Intergenic
1171360202 20:24582054-24582076 GGGGAGGACATGAAGGAGGGAGG - Intronic
1171360301 20:24582388-24582410 GGGGAGGACATGCAGAAGGGAGG - Intronic
1171364680 20:24615761-24615783 CAGGAGGACATTAAGAACTTCGG - Intronic
1172031448 20:31984841-31984863 CAGGAGGCCATGAAGAGCCAGGG + Intronic
1172426111 20:34857184-34857206 CAGCAGGACATGAGGTGGGAGGG - Intronic
1172588928 20:36104240-36104262 CAGAAGGGCATGAAGTAGGAAGG + Intronic
1172787678 20:37479936-37479958 GAAGAGGACACCAAGAAGGAAGG - Intergenic
1173190559 20:40872554-40872576 CAGAAGGACATGAGGAAAGGTGG - Intergenic
1173616637 20:44407454-44407476 CGGGCTGGCATGAAGAAGGAAGG + Exonic
1173648156 20:44646444-44646466 CAGGAAGACAAAAAGGAGGAGGG + Intronic
1173719176 20:45238334-45238356 AAGGAAGAAAGGAAGAAGGAAGG + Intergenic
1174166109 20:48584635-48584657 AAGGAGGGAAGGAAGAAGGAAGG - Intergenic
1174296589 20:49549714-49549736 CAGGTGGACAGGCAGAAGAATGG + Intronic
1174585953 20:51608476-51608498 AAGGAGGAAAGGAGGAAGGAGGG + Intronic
1174829393 20:53798677-53798699 TGGGAGGACATGAAGGAAGAGGG - Intergenic
1174860423 20:54086270-54086292 CTGGAGGACATGCAGGAGAAGGG - Intergenic
1174921158 20:54703970-54703992 CAGAACGACAGGAAGGAGGAGGG - Intergenic
1175531982 20:59680088-59680110 GATGGGGACAGGAAGAAGGAAGG - Intronic
1175988756 20:62777206-62777228 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1175988760 20:62777225-62777247 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1175988767 20:62777260-62777282 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1176244153 20:64089461-64089483 TAGGAGGACAGGAAGAAAGGAGG - Intronic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1176998943 21:15588324-15588346 CAGGTGGAGATGGGGAAGGAGGG - Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178664362 21:34533809-34533831 CATGAGGACCTGAAGCAGGTAGG + Intronic
1179317024 21:40253067-40253089 CAGGAAGACATAAACCAGGAGGG + Intronic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1180121332 21:45750406-45750428 CAGGAGTCCAGGAAGAAGGGGGG - Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180898265 22:19353117-19353139 CAGCAGGACAGGCAGCAGGACGG - Intronic
1181098601 22:20523471-20523493 CAGGAGGTGATGAGGAAGGGTGG - Intronic
1181102432 22:20550354-20550376 CAGGACAACATGAAGAAGAAAGG - Intronic
1181794719 22:25297921-25297943 CAGCAGCACATGAAAAAGAAAGG + Intergenic
1182085933 22:27561220-27561242 CAGGAGGACATGAACAGAGCAGG + Intergenic
1182170585 22:28224733-28224755 CAGGAGGAACTGTAGAATGAAGG - Intronic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182481999 22:30615180-30615202 CAGGAGGGCTTGGAGAAGAAGGG - Intronic
1182868334 22:33624503-33624525 TGGGAGGAAATGGAGAAGGAGGG + Intronic
1183058622 22:35321934-35321956 AAGGAGGACAAGAAAAAGGGTGG - Intronic
1183266199 22:36827339-36827361 GAGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183286574 22:36968744-36968766 TAGGAGGAGGGGAAGAAGGAAGG - Intergenic
1183616756 22:38950420-38950442 CAGGAGGGCAGGAAGAAGTCTGG + Intergenic
1183660918 22:39220688-39220710 CAGGTGGACAGGTAGACGGATGG + Intergenic
1183667434 22:39253847-39253869 CAGGAGGACCTGGGGAAGGAAGG - Intergenic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184391120 22:44204234-44204256 CGTGGGGACATGAAGATGGAGGG - Intronic
1184449692 22:44575669-44575691 GAGGAGGAGAAGAAGAAAGAAGG + Intergenic
1184505604 22:44899629-44899651 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
1184821133 22:46909925-46909947 CAGAGGGAGATGAAGAAGCAGGG - Intronic
1184900803 22:47445342-47445364 CAGGTGGACAGGCAGGAGGATGG - Intergenic
1185427213 22:50779193-50779215 CTGGAAGACAGGATGAAGGAGGG + Intronic
949095197 3:77363-77385 CAGGAGGAAGATAAGAAGGAGGG - Intergenic
949875789 3:8625235-8625257 AAGGAGGGGATGAGGAAGGAAGG + Intronic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950570733 3:13798492-13798514 CAGGAGGGCATGCAGAAAGGGGG + Intergenic
950769553 3:15300777-15300799 CAGGTGGGCAGGAAGAAGCAGGG - Intronic
951330612 3:21363971-21363993 GAGGAATACAAGAAGAAGGAAGG + Intergenic
951729598 3:25796061-25796083 AAGGAGAAGATAAAGAAGGAAGG + Intergenic
952005501 3:28837934-28837956 CAAGAAGACTTGAAGAAAGATGG + Intergenic
952022881 3:29044069-29044091 AAGGAGGTGAGGAAGAAGGATGG - Intergenic
953241947 3:41157521-41157543 AGGGAAGAAATGAAGAAGGAAGG - Intergenic
953242410 3:41161332-41161354 CAGGAGGGTATGAGGAAGGCTGG - Intergenic
953370923 3:42387834-42387856 CAGGAGGAGATGGAAAAAGAGGG - Intergenic
953381580 3:42476535-42476557 CAGGAGCCTTTGAAGAAGGAGGG - Intergenic
953721954 3:45363919-45363941 GAGGAGGAATAGAAGAAGGAGGG - Intergenic
953732715 3:45464089-45464111 CAGGAGGACAGGAACAAAGAGGG - Intronic
955037321 3:55281804-55281826 GAGGAGGAAGTAAAGAAGGAAGG + Intergenic
955202439 3:56863061-56863083 AAGAAGGACTTGAAGAAAGATGG + Intronic
955598548 3:60618855-60618877 AAGGAGGCTTTGAAGAAGGAAGG + Intronic
955913042 3:63878053-63878075 CAGGATGAAAGAAAGAAGGAAGG + Intronic
956137964 3:66117553-66117575 CAGTGGGAAATGAAGAAGGTAGG + Intergenic
956277624 3:67520243-67520265 CAGGAAGAAGTAAAGAAGGAAGG + Intronic
956449482 3:69359219-69359241 CAGGAGGACATGATAAAGAGGGG + Intronic
956547776 3:70424958-70424980 GAGGAGGAGAAAAAGAAGGAGGG + Intergenic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
957070512 3:75564487-75564509 CAGAAGGACAAGCAGATGGATGG + Intergenic
958054597 3:88393040-88393062 CAGGAGGAAAGGAGGAAGAATGG + Intergenic
958504514 3:94957356-94957378 AGGGAGGAAAGGAAGAAGGAAGG - Intergenic
958558228 3:95707235-95707257 CACTATGACATGAAGAAGTAAGG - Intergenic
958584092 3:96062829-96062851 GAGGAGGAGAAGGAGAAGGAGGG - Intergenic
958777467 3:98503524-98503546 CAGGAGGGGATGAAGAGGCAAGG - Intronic
959228237 3:103614422-103614444 AAGAATGACATGAAGATGGAAGG + Intergenic
959364513 3:105440245-105440267 CAAGAGAACATGAACCAGGAAGG + Intronic
959697519 3:109264497-109264519 GAGGAGGAGAGGAGGAAGGAAGG + Intergenic
960252497 3:115471536-115471558 TAGGATGACATGTAGGAGGAGGG + Intergenic
961283573 3:125782049-125782071 CAGAAGGACAAGCAGATGGATGG - Intergenic
961396777 3:126599168-126599190 AAGGAGGAAAGGAAGAAGGAAGG - Intronic
962374334 3:134847622-134847644 GATGAGGACAAGAAGAAGGCAGG + Intronic
962424968 3:135261615-135261637 CAGGAACACATGAAGCATGAAGG + Intergenic
963238748 3:142982117-142982139 CAGGGGTACATGAAGACAGACGG + Intronic
963460004 3:145600036-145600058 GAGGAGGAGAAGGAGAAGGAGGG + Intergenic
963599009 3:147361138-147361160 GAGGAGGAAAGGAGGAAGGAGGG - Intergenic
963912988 3:150830866-150830888 AAGGAGGACAGAAGGAAGGAAGG - Intergenic
963988220 3:151622480-151622502 AAGGAGGAGAAGAAGAAAGATGG - Intergenic
964137662 3:153363401-153363423 CAGGAGGACAGGAATTAGGGAGG + Intergenic
965680595 3:171247478-171247500 CGGGAAAACATGAAGAAGGCAGG + Intronic
966065208 3:175813186-175813208 CAGGAGGAAAAGGAGAATGATGG + Intergenic
966571442 3:181448372-181448394 CAGGAGGAAAGGAGAAAGGATGG + Intergenic
966591748 3:181691427-181691449 CAGGAGGAGATAGAGGAGGAAGG + Intergenic
967031285 3:185609747-185609769 CAGGAGGAGGTGAAGGAGAAAGG - Intronic
967249249 3:187520068-187520090 GAGGAGGAGAAGGAGAAGGAAGG + Intergenic
967882193 3:194309529-194309551 CAGGACCACAGGAAGAAGGAGGG - Intergenic
968751418 4:2391259-2391281 CACCAGGACATGAAAGAGGAAGG - Intronic
969017731 4:4115633-4115655 CAGGAGCCCATGGAGCAGGAAGG - Intergenic
969130107 4:4984910-4984932 CAGGAGGAAAGAAAGAAGAAAGG - Intergenic
969277780 4:6148622-6148644 CAGGAGCAGAGGAAGAAGGGAGG + Intronic
969354533 4:6617622-6617644 CAGAAGACCATGAAGAAGGGCGG - Intronic
969739853 4:9016265-9016287 CAGAAGGACAAGCAGATGGATGG - Intergenic
970331854 4:14994783-14994805 AAGGAGGAAATTATGAAGGAAGG + Intergenic
970640151 4:18055406-18055428 AAGGAGGAAAGGAGGAAGGAAGG - Intergenic
970681873 4:18518196-18518218 CAGAAGGAAAGGAAGAAGGGAGG - Intergenic
970710465 4:18856146-18856168 CAGTAGTAGATGAAGAAGTAAGG + Intergenic
970766225 4:19551945-19551967 CAGAAGGACATGAATTTGGAGGG + Intergenic
970915013 4:21322111-21322133 AAGGAAGAAAGGAAGAAGGAAGG + Intronic
972587556 4:40451862-40451884 CAAGGGTAGATGAAGAAGGAAGG + Intronic
972716615 4:41652805-41652827 CATGATCACATGGAGAAGGATGG + Intronic
972913792 4:43850723-43850745 AAGGAGGATATGAGGAAAGAAGG - Intergenic
973319071 4:48791436-48791458 CAGGAAGACATGAAGAAGTTGGG + Intergenic
973796951 4:54437087-54437109 GTGGAGGGCAGGAAGAAGGAAGG + Intergenic
974409554 4:61521769-61521791 CAGGAGGAGATGGAGAATGTAGG + Intronic
974554089 4:63420795-63420817 AAGGAAGAAAAGAAGAAGGAAGG - Intergenic
975205253 4:71638202-71638224 CAGGAAGACCTGAAGTGGGAAGG - Intergenic
975838972 4:78454425-78454447 CAGGAGGGCATGCAGAGAGATGG + Intronic
976285477 4:83366762-83366784 CAGGGAGAGATGAAGAAAGAGGG + Intergenic
976788971 4:88855907-88855929 TAAGTGGACATGAAGCAGGAGGG + Intronic
978197925 4:105991972-105991994 CAGGAGGACATGAAGAAGGATGG - Intronic
980540562 4:134187982-134188004 CTGGAAGACATAAAAAAGGAGGG - Intergenic
981212893 4:142129842-142129864 CATGATGTCATGAAAAAGGAGGG - Intronic
981259194 4:142699305-142699327 AATGAGGACATGAGGAGGGAAGG - Intronic
981957040 4:150490111-150490133 CAGGAGGAGATCAAACAGGAAGG + Intronic
982505608 4:156213602-156213624 CAGGAAGACTTGAAGCAGGAGGG + Intergenic
982920330 4:161266589-161266611 CAGGACGACTTGAAGCAGGGAGG + Intergenic
983739691 4:171113869-171113891 AAGGAAGGCATGAAGGAGGAAGG + Intergenic
984149396 4:176108000-176108022 CAGGAGGAAGGGAAGAAGGGTGG - Intronic
984908842 4:184653088-184653110 AAGGAGGGAAAGAAGAAGGAAGG + Intronic
984911872 4:184681238-184681260 TAGGAAGAAATGAAGAAAGAAGG - Intronic
985443995 4:190009776-190009798 TAGGTGAACATGAAGAAGTATGG + Intergenic
985993779 5:3584932-3584954 AAGAAGGACAGGAGGAAGGAAGG + Intergenic
986068184 5:4256294-4256316 CGGGAGGACATCAAGTAGGATGG - Intergenic
986383218 5:7207123-7207145 AGGAAGGACAGGAAGAAGGAAGG - Intergenic
986398785 5:7358700-7358722 AAAGAAGAAATGAAGAAGGAAGG + Intergenic
986837778 5:11660211-11660233 CACAAGGCCATGAAAAAGGATGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987910136 5:24132395-24132417 GAGGAGGAGAGGGAGAAGGAGGG + Intronic
988477273 5:31597876-31597898 AAGGAGGAAAGGAAGAGGGAAGG + Intergenic
988782864 5:34539408-34539430 CAGGAGGAAAGTAATAAGGAAGG + Intergenic
988915860 5:35892948-35892970 CAGGAGCCCATGAAGTAGGTGGG + Intergenic
989307983 5:39979736-39979758 CAGCAGAAGATGAAGAGGGAGGG - Intergenic
989417360 5:41195382-41195404 CAGGAGCAAATGGAGAAAGAGGG - Intronic
989568617 5:42925023-42925045 AAGGAGGACGAGGAGAAGGAAGG - Intergenic
990045801 5:51429352-51429374 AAAGAGGACATTAAGAACGATGG - Intergenic
990507491 5:56458947-56458969 AAGGAGGGAAAGAAGAAGGAAGG - Intronic
990616157 5:57510703-57510725 GAGGAGGAAAGGAAGGAGGAGGG - Intergenic
992296331 5:75330597-75330619 CAGAAGGAAATGAAAATGGAGGG - Intergenic
992629872 5:78669569-78669591 AAGGAGGAAAGGAGGAAGGAAGG + Intronic
992689055 5:79225684-79225706 CAGGAGGATAAGTGGAAGGATGG - Intronic
994776268 5:104038715-104038737 CAGGACAACTTGAAGCAGGAAGG - Intergenic
995264787 5:110145967-110145989 CATCAGGACACGAAGATGGAAGG - Intergenic
995860842 5:116638939-116638961 AAGCAGGAAAGGAAGAAGGAGGG + Intergenic
996632997 5:125659867-125659889 CAAGAAGTCATGAAGAAAGAGGG + Intergenic
996823458 5:127655427-127655449 CAGTAGGATATGAAAAAGCAAGG + Intronic
996991057 5:129632502-129632524 CAGGAAGTCATGAAGAACAATGG - Intronic
997855844 5:137371849-137371871 CAGCAACCCATGAAGAAGGAAGG + Intronic
997859414 5:137403074-137403096 AAGGAGTAAATGGAGAAGGAAGG - Intronic
998195239 5:140063414-140063436 CAGGAGGAAAAGGAGAAGAAAGG + Intergenic
998224248 5:140314269-140314291 CAGAAGGCCATGAAGAATCAGGG + Intergenic
999070569 5:148739474-148739496 CAGGAAGTCAGGAAGCAGGACGG + Intergenic
999751702 5:154632328-154632350 GAGGAGGGAAGGAAGAAGGAGGG - Intergenic
999773516 5:154793186-154793208 TAGGAGGAAAGGAAGAGGGAAGG + Intronic
1000503311 5:162080097-162080119 CAGGAAGACAGGAAGTAGGCGGG - Intronic
1001251837 5:170152761-170152783 TAGGAGGCCAGGAAGAAGGAAGG - Intergenic
1001285265 5:170418471-170418493 CAGGAGGACTTGAGGAGGCAAGG - Intronic
1001775994 5:174329380-174329402 CAGGAGTAAATGCAGAAAGAGGG + Intergenic
1001907085 5:175481690-175481712 CAGGAAGACATGGAGAATCAAGG - Intronic
1001942015 5:175747233-175747255 CAGCAGAGCATAAAGAAGGAAGG + Intergenic
1002320453 5:178372416-178372438 CAAGAGGAAATGAAGAAGGAAGG + Intronic
1002636838 5:180612831-180612853 CAGGAGGACACCAGGAGGGAAGG - Intronic
1002862905 6:1095766-1095788 CATGAGGACATGAAAGTGGAGGG + Intergenic
1003171583 6:3725260-3725282 CCTGAGGACATGAGGAGGGAGGG + Intronic
1003373661 6:5553247-5553269 CAGGAGTAGATGAGGATGGATGG + Intronic
1004190447 6:13458918-13458940 CAGGTGGACAGCAAGAAGAAAGG + Intronic
1004293203 6:14387030-14387052 CTGGTGGACATAAAGAAGCATGG + Intergenic
1004293961 6:14393456-14393478 GAGGAGGAGAGGAAGAAAGAAGG + Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005214064 6:23504429-23504451 CAGGAGAACAGAAAGGAGGAAGG - Intergenic
1005595759 6:27377566-27377588 CAGGAAGACATGAAGCTGGGAGG - Intronic
1005705334 6:28446047-28446069 GAGGAGGGAATGAAGAAGGAAGG - Intergenic
1005732273 6:28709678-28709700 GAGGAGGACGAGAAGAAGGAAGG - Intergenic
1005979194 6:30823434-30823456 AAGGAGGAGAAGAAGAAGAAGGG - Intergenic
1006818213 6:36868015-36868037 CAGAAGGACAGAAAGGAGGAGGG + Intronic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007575463 6:42922891-42922913 TAGAAGGACATGTAGATGGATGG + Intronic
1007654509 6:43444239-43444261 CAGGAAGAAAGCAAGAAGGAGGG + Exonic
1007848507 6:44780829-44780851 CATAACTACATGAAGAAGGAAGG + Intergenic
1008199799 6:48572248-48572270 AAGGAAGGAATGAAGAAGGAAGG - Intergenic
1008945664 6:57094226-57094248 CAGAAGCACATGTAGAAGCATGG - Intronic
1010168127 6:72941383-72941405 AAGGAGGAAAGGAGGAAGGAAGG - Intronic
1010168147 6:72941455-72941477 AAGGAGGGAAGGAAGAAGGAAGG - Intronic
1010890953 6:81309771-81309793 CAGGTGGATTTGAAGAAGCATGG + Intergenic
1011509847 6:88088383-88088405 CAGGAGAACCTGCAGAAGGGAGG + Intergenic
1011807366 6:91087284-91087306 CAGGAGGCCATGAAGAATCATGG - Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012697667 6:102408609-102408631 AGGGAGGGAATGAAGAAGGAAGG - Intergenic
1012724420 6:102791102-102791124 AAGGAAAACATGAAGAAGGATGG + Intergenic
1012961901 6:105630964-105630986 CTAGAGGAGATAAAGAAGGAGGG + Intergenic
1012981971 6:105840669-105840691 CAGGAAGAGCTGTAGAAGGAGGG - Intergenic
1013273216 6:108560943-108560965 CAGGAGGACCTGAAGACGTGCGG - Exonic
1013325205 6:109038878-109038900 GAAGAGGAAAAGAAGAAGGAAGG + Intronic
1013859523 6:114618502-114618524 ATGGAGGACAGGAAGATGGAGGG - Intergenic
1014095671 6:117457917-117457939 GAGGAAGAGATGAAGAAGTAAGG - Intronic
1014820981 6:125988056-125988078 GAGGAGGCCATGAAGAAGATGGG + Intronic
1014846737 6:126287050-126287072 CAAGTTGACAGGAAGAAGGAGGG - Intergenic
1015416798 6:132958220-132958242 AAGGTGGAAAAGAAGAAGGAAGG + Intergenic
1015478025 6:133675319-133675341 AAGGAGGAAATGAAGGAAGAAGG + Intergenic
1016194674 6:141319555-141319577 TAAAAGGACATCAAGAAGGAAGG + Intergenic
1016521134 6:144948350-144948372 CAGAAGGCAATGGAGAAGGAGGG - Intergenic
1016647068 6:146422995-146423017 AAGGAGGGAAAGAAGAAGGAAGG + Intronic
1016934039 6:149435911-149435933 GACGAGGACGTGAAGGAGGACGG + Intergenic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017510484 6:155110290-155110312 AAAGAGGAAAGGAAGAAGGAAGG - Intronic
1017950182 6:159129600-159129622 CAGGAAAGCAGGAAGAAGGAAGG - Intergenic
1018231908 6:161683169-161683191 CAGAAGGGAAGGAAGAAGGACGG + Intronic
1018853045 6:167654965-167654987 CAGGTGGACACGTAGATGGATGG + Intergenic
1019327619 7:446059-446081 GAGAAGGAAAGGAAGAAGGAGGG + Intergenic
1019535334 7:1526319-1526341 GAGGAGGAGAAGAAGAAGAAGGG + Intergenic
1019742105 7:2680164-2680186 CAGTGGCACTTGAAGAAGGAGGG + Intronic
1019827619 7:3297732-3297754 GAGGAGGAGAAGAAGAAGAAGGG + Intergenic
1022231963 7:28423078-28423100 CAGGAGAAAAGGAAGAAGGGAGG - Intronic
1022473397 7:30695073-30695095 AAGGTGGACATGAGGAAGGAGGG + Intronic
1023533527 7:41183488-41183510 AAGGAAGACAGAAAGAAGGAAGG - Intergenic
1023640337 7:42250890-42250912 GAGGAAGACAGGAAGAAGGTAGG - Intergenic
1024131783 7:46360831-46360853 AAGGAGGACAGGAAGAAGCCAGG + Intergenic
1024270166 7:47635884-47635906 CAGGAGGAGAGGAAGAAGTGAGG + Intergenic
1024354652 7:48402192-48402214 ATGGAAGAAATGAAGAAGGAGGG + Intronic
1024402706 7:48943766-48943788 AAGGAAGAAAGGAAGAAGGAAGG - Intergenic
1024471087 7:49769447-49769469 AAGGAGGGAAAGAAGAAGGATGG - Intergenic
1024531121 7:50393422-50393444 CAGGATGACATGAAGGGGGAAGG + Intronic
1024803737 7:53111421-53111443 AAGGAGGAAAGGAAGAATGAAGG - Intergenic
1025031574 7:55561260-55561282 AAGGAGGTCATCAAGAGGGAAGG - Intronic
1025945194 7:66099535-66099557 GAGGAGGAAAGGAAGAAGGGAGG + Intronic
1026063933 7:67052629-67052651 CAGGAAAACATGACGAATGAGGG - Intronic
1026238030 7:68545772-68545794 AAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1026528376 7:71175541-71175563 GAGGATGAAATAAAGAAGGAAGG + Intronic
1026677970 7:72444221-72444243 AAGTAGCACATGAAGAGGGAAGG + Intronic
1026714420 7:72774829-72774851 CAGGAAAACATGATGAATGAGGG + Intronic
1027233153 7:76283323-76283345 CAGGAGGCCACGCAGAAGGAAGG + Intronic
1027338608 7:77181410-77181432 GAGGAGGAGATGAAGAAGGCAGG + Intronic
1027889736 7:83956528-83956550 GAGGTGAACATTAAGAAGGAAGG + Exonic
1028446823 7:90934093-90934115 CAGGGGCACATGATGAAGGTTGG - Intronic
1028480745 7:91301851-91301873 GGGGAGGAAAAGAAGAAGGAAGG - Intergenic
1028987482 7:97019502-97019524 CAGGAGTGCAAGAAGAAGGAAGG + Intergenic
1029204880 7:98863637-98863659 AAGGAGGGAAGGAAGAAGGAGGG - Intronic
1029882401 7:103829308-103829330 GAGGAGGAGAGGAGGAAGGAGGG - Intronic
1029929067 7:104351564-104351586 CAGGAGAAAATTAAGATGGAAGG + Intronic
1030115276 7:106058163-106058185 CAGAAGGAGATCAAGAATGAGGG + Intergenic
1030150111 7:106395829-106395851 GAGGAGGATAGAAAGAAGGAAGG + Intergenic
1030687820 7:112504799-112504821 TAGGAGGACAAGAAGATGGGAGG + Intergenic
1030946430 7:115727485-115727507 CAAGAGGACAGGTTGAAGGAGGG + Intergenic
1031049929 7:116934777-116934799 AGGGAGGACAGGAGGAAGGAAGG - Intergenic
1031083759 7:117282447-117282469 GAGGAGGAGAGGAAGGAGGAGGG + Intronic
1031085424 7:117297716-117297738 CAGGTGGTCATGAACCAGGATGG - Exonic
1032515029 7:132500455-132500477 GAGAAGGAGAAGAAGAAGGAGGG + Intronic
1032676008 7:134130005-134130027 CAGAAGGACATTACAAAGGAAGG - Intronic
1033031041 7:137827067-137827089 CTCTAGCACATGAAGAAGGAAGG - Intronic
1033181720 7:139185895-139185917 AAGGAGGAAAGGAAGAATGAAGG + Intronic
1034316040 7:150134291-150134313 CAGGAGGAGAGGAAGATGAACGG + Intergenic
1034381146 7:150693972-150693994 GAGGAATACATGAACAAGGAAGG + Intergenic
1034512899 7:151550878-151550900 CAGCAGGACTTGAAGGAGGCAGG + Intergenic
1034790848 7:153966490-153966512 CAGGAGGAGAGGAAGATGAACGG - Intronic
1034995765 7:155576442-155576464 CTGAAGCACATGAAGCAGGAGGG - Intergenic
1035397710 7:158546153-158546175 CATGAGGACAGGAAGGGGGAAGG + Intronic
1036046089 8:5142329-5142351 CAGAAAGACAAGACGAAGGAAGG - Intergenic
1036193402 8:6692637-6692659 CAGAAAGACATGGAGAAGGCCGG + Intergenic
1036213543 8:6861780-6861802 CAGGAAGACTTGAAGCAGGGAGG - Intergenic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1036538169 8:9672864-9672886 AAGGAGGAAAGGAAGACGGAAGG - Intronic
1036695007 8:10968527-10968549 CTGGAGGACAGGAGGAGGGAGGG - Intronic
1037213803 8:16424888-16424910 GAGGAGGAAGTAAAGAAGGAAGG - Intronic
1037277709 8:17199624-17199646 GAGGAGGAGAAGAAGAAGAAAGG - Intronic
1037380372 8:18278582-18278604 CTGGAGATCTTGAAGAAGGAGGG - Intergenic
1037426605 8:18762264-18762286 CAGGAGGAAGAGAGGAAGGAAGG - Intronic
1037503481 8:19507392-19507414 CAGGGGGAAATGGAGAAGGCAGG - Intronic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1037756023 8:21710538-21710560 CAGCATGGCATGGAGAAGGACGG - Intronic
1038048661 8:23789109-23789131 CAGGAGAACCTGAACAAGGCTGG + Intergenic
1038328312 8:26588853-26588875 CACGAGGACATGAAGATGCTAGG - Intronic
1038507650 8:28099383-28099405 CAGGAAGACAAGAAGAAGGCTGG + Intronic
1038627347 8:29206969-29206991 CAGGAGGGCATGAAGCAGGGTGG - Intronic
1038649104 8:29386180-29386202 CAGGAGGATGTGAAGAATTAGGG - Intergenic
1038781733 8:30574005-30574027 CAAGATGACATAAAGAAGTAAGG + Intergenic
1038841497 8:31188690-31188712 CAGGAGGACATCACCAAGGATGG - Intergenic
1038846013 8:31230208-31230230 CAGTAGGAAAGAAAGAAGGAAGG - Intergenic
1039691307 8:39867675-39867697 GAGAAGGAGAAGAAGAAGGAGGG - Intergenic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1041444203 8:57931982-57932004 AGGGAGGAAAGGAAGAAGGAAGG + Intergenic
1041444223 8:57932050-57932072 GAGGAAGAAAGGAAGAAGGAAGG + Intergenic
1042130488 8:65582761-65582783 GAGGAGGAGATGGAAAAGGAGGG + Intergenic
1042668373 8:71232585-71232607 GAGGAGCCCATGAATAAGGATGG + Intronic
1043094235 8:75946384-75946406 AAGGAAGAAAGGAAGAAGGAAGG - Intergenic
1043858530 8:85289016-85289038 CATGAGGACTTGATGAAGGATGG - Intergenic
1044386760 8:91598302-91598324 TAGAAGAACAGGAAGAAGGAAGG + Intergenic
1044582445 8:93835621-93835643 CAGGAAGAAATGAAGAAATACGG - Intergenic
1045280052 8:100742331-100742353 CAGGTGGGCAGGAAGAATGATGG + Intergenic
1045312973 8:101019354-101019376 CAGGAGCACATAAAGGGGGAAGG - Intergenic
1046145974 8:110158730-110158752 GAGGAAGACAGAAAGAAGGAAGG - Intergenic
1046257770 8:111722910-111722932 CAGGAAGACATGTAGAAGTTTGG - Intergenic
1046909250 8:119607719-119607741 CTGGAGGACAAAAAGAAGGTAGG + Intronic
1047039630 8:120978591-120978613 CAGGATGAGATCCAGAAGGAAGG + Intergenic
1047676842 8:127211927-127211949 GAGGTGGACAGGAAGAGGGAAGG - Intergenic
1047806393 8:128365196-128365218 AAGAAGGAAAGGAAGAAGGAAGG + Intergenic
1048029640 8:130619195-130619217 CAGCAGCACATTAAAAAGGATGG - Intergenic
1048253238 8:132884683-132884705 CAGGTGGAAATGAAGAACTATGG + Intronic
1048280394 8:133101445-133101467 AAGGAGGACCTGAAGATGGCAGG + Intronic
1049701310 8:144014414-144014436 GAGGAGGAGAGGAAGAAAGAAGG + Intronic
1049767285 8:144360721-144360743 CAGGGGGACATGAAGTGGGGTGG + Intronic
1049829176 8:144688936-144688958 AAGGAGGACATGAAGGGGGACGG + Intergenic
1049865955 8:144935878-144935900 CTGTAGGAGATGAAGAAGTAAGG - Intronic
1050011362 9:1188761-1188783 CAGAAAGAAAGGAAGAAGGAAGG - Intergenic
1050250424 9:3737776-3737798 CAGGATGGCAGGAAGAAGGAAGG + Intergenic
1050475911 9:6040925-6040947 AAGGAGAAGATGAAGAAGTAAGG - Intergenic
1050960971 9:11730448-11730470 CAAGTGGAGATGAAGAAGCAAGG + Intergenic
1050970145 9:11860225-11860247 CAGGAGGACAAGAAAGAGTATGG + Intergenic
1051641745 9:19230433-19230455 CAGGAGGAAAGGGAGAGGGAGGG + Exonic
1052419165 9:28219963-28219985 CTGGATGACATGAACTAGGATGG + Intronic
1052613024 9:30800394-30800416 CAGGAGCACCTGGAGAAGAAGGG - Intergenic
1052814666 9:33092251-33092273 AAGGAGGAGAAGTAGAAGGAGGG - Intergenic
1053460847 9:38269967-38269989 GAGGAGGACAGGGAGAAGCAAGG + Intergenic
1054907139 9:70421172-70421194 CAGGAGGAGAGGAAGGGGGAGGG - Intergenic
1055037674 9:71835830-71835852 AAGGAAGAAAAGAAGAAGGAAGG - Intergenic
1055270007 9:74547310-74547332 AAGGATGAAAGGAAGAAGGATGG + Intronic
1055708251 9:79031882-79031904 CAGGAGGGGAAGAAGAAGGAGGG + Intergenic
1055957604 9:81788797-81788819 CAGGAGGACAAAAATAAGAAGGG - Intergenic
1056450467 9:86711734-86711756 CATAGGGAAATGAAGAAGGAAGG + Intergenic
1056505694 9:87256300-87256322 CAGGTAGACATCAAGCAGGAGGG - Intergenic
1057739513 9:97699257-97699279 CAGGAGCACCTGTAGAAGAAGGG + Intergenic
1057899821 9:98939690-98939712 CAAGAGGAAAAGAAAAAGGAGGG - Intergenic
1058056437 9:100453785-100453807 CATGAGGCCATGCAGAAGGAAGG + Intronic
1058613578 9:106801527-106801549 CAGTAGAAAATGAAGAAGAAAGG + Intergenic
1059136184 9:111808635-111808657 CAGGAAGACTTGAAGCAGGGAGG - Intergenic
1059459187 9:114419014-114419036 AGGAAGGACAAGAAGAAGGAAGG + Intronic
1059562867 9:115352048-115352070 AAGGAGGACAGGAGCAAGGAAGG + Intronic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1060453928 9:123772097-123772119 GGGGAGGACAGGAAGAGGGAGGG + Intronic
1060967646 9:127720806-127720828 CAGGAGGGAAGAAAGAAGGAGGG - Intronic
1061200606 9:129136443-129136465 CAGGAGGACAGGGAAAGGGAAGG - Intronic
1061865785 9:133491149-133491171 GAGGAGGACTTGGAGGAGGAGGG + Intergenic
1061886877 9:133595644-133595666 CGGGTGGACATGGGGAAGGAAGG - Intergenic
1061967582 9:134025059-134025081 GAGGAGGAGATGGAGGAGGAGGG - Intergenic
1062097852 9:134712086-134712108 AAGGGGGATAGGAAGAAGGAAGG - Intronic
1062097981 9:134712495-134712517 AAGGGGGACAGGAAGGAGGAGGG - Intronic
1062103776 9:134741748-134741770 CAGGAGGCCAAGCAGACGGAGGG - Intronic
1062190684 9:135246418-135246440 CAGGAGGACAAGAACTAGGTGGG + Intergenic
1062234752 9:135502467-135502489 CAGGTGGACATGAGGCAGCAGGG + Intronic
1062440204 9:136566340-136566362 CAGGTGCCCATGAACAAGGAGGG + Intergenic
1185458784 X:324101-324123 CAGGAGGCCGCGCAGAAGGAGGG + Intergenic
1185485196 X:476784-476806 CAGGAGGAAAGAAAGAAGGAAGG + Intergenic
1185540446 X:899193-899215 CGGGAGGAGAAGAAGAAAGAGGG - Intergenic
1185575534 X:1169173-1169195 CAGGAGGACAGGGAGGGGGAGGG + Intergenic
1185700001 X:2223620-2223642 CAGGAGGAAAGGGAGAGGGAAGG + Intronic
1185766857 X:2732615-2732637 AAGGAGGAAAAGAAGAAGGGAGG - Intronic
1186019153 X:5234911-5234933 GAGGAAGAGAGGAAGAAGGAAGG - Intergenic
1186077597 X:5897964-5897986 GAGGAGGAGAGGAAGAAGGGAGG - Intronic
1186226795 X:7407540-7407562 CGGCAGGAGAGGAAGAAGGAGGG - Intergenic
1186258182 X:7745655-7745677 AAGGAGGACAAGGAGAAAGAAGG + Intergenic
1186368310 X:8919178-8919200 CAGGAGGAAATGTCTAAGGAGGG + Intergenic
1186682600 X:11891387-11891409 GAGGAAGAAATGAAGAATGAGGG + Intergenic
1187912088 X:24120480-24120502 AAGGAGGAAAGGAAGAAGGAAGG - Intergenic
1188312531 X:28635125-28635147 CAGGTTGACATGAAGAGAGATGG - Intronic
1189238130 X:39504367-39504389 GAGAAGGAGATGAAAAAGGAAGG - Intergenic
1189376762 X:40472593-40472615 GAGGAGGGGAGGAAGAAGGACGG - Intergenic
1189465232 X:41273352-41273374 AAGGAAGAAAGGAAGAAGGAAGG + Intergenic
1189917719 X:45873231-45873253 CAGGAAGGGATGAAGAAGAAGGG + Intergenic
1189928615 X:45983698-45983720 CAGGAGCACCTGGAGAAGAAGGG + Intergenic
1190260389 X:48793508-48793530 GAGGAGGGAATGGAGAAGGAAGG - Intronic
1190571698 X:51789067-51789089 TGGGAGGACATGAAGAAGAAGGG + Intergenic
1190953148 X:55165547-55165569 AAGGAAGAAAGGAAGAAGGAAGG - Intronic
1191000980 X:55659338-55659360 CAGGAGGACATGGGGGAAGAAGG + Intergenic
1191024999 X:55904920-55904942 CATGAAGTCATGAAGAAAGAAGG + Intergenic
1191958050 X:66667606-66667628 GATGAGGAGAAGAAGAAGGAGGG - Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192042933 X:67642394-67642416 CAGGTGGATATGAAGGAGAAGGG - Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192237047 X:69302649-69302671 CAAGAGCACAAGAAGAAGAAGGG - Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1194566915 X:95500508-95500530 CAGGATGACATGCAGAAAAATGG + Intergenic
1194643798 X:96433550-96433572 CATGGAGCCATGAAGAAGGAAGG + Intergenic
1194981812 X:100449380-100449402 CAGGAAAATATGAAGAAGGAAGG - Intergenic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1197566729 X:128097188-128097210 CGGCAGGAGGTGAAGAAGGAAGG - Intergenic
1198402130 X:136278527-136278549 GAGGATGTCATTAAGAAGGACGG + Intergenic
1198402182 X:136278889-136278911 GAGGATGTCATTAAGAAGGAGGG - Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199134145 X:144231333-144231355 CAGGAGCCCATGGAGAAGGGGGG + Intergenic
1199362547 X:146939865-146939887 AAGGAAGACAGGAGGAAGGAAGG - Intergenic
1199522718 X:148754464-148754486 CAGGAAGGCATGAAGAGGGCAGG + Intronic
1199692342 X:150318166-150318188 CAGGGGGACAAGATGAAGAATGG - Intergenic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1199849414 X:151714794-151714816 AAGGAGGAAAAGAAGAAGGAAGG - Intergenic
1200133514 X:153863797-153863819 CAGGAGGCCTTGCAGAAGGGTGG + Intronic
1200179274 X:154140562-154140584 GAGAAGGATATGAAGAACGAGGG - Intergenic
1200746143 Y:6905566-6905588 AAGGAAGACAGGAAGAAAGAAGG - Intergenic
1201671849 Y:16530659-16530681 GAGGAGGAGAAGAAGAAGAAAGG + Intergenic