ID: 978203521

View in Genome Browser
Species Human (GRCh38)
Location 4:106051180-106051202
Sequence AACAGAATCATGTCTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978203517_978203521 24 Left 978203517 4:106051133-106051155 CCAAAAAATTAAAAGCTGATGAT 0: 1
1: 0
2: 2
3: 34
4: 466
Right 978203521 4:106051180-106051202 AACAGAATCATGTCTCTCACTGG 0: 1
1: 0
2: 0
3: 23
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978203521 Original CRISPR AACAGAATCATGTCTCTCAC TGG Intronic
900005762 1:49184-49206 AACAAGATCATGTCTTTGACAGG + Intergenic
900831383 1:4968194-4968216 ATCAGATACATGTCTGTCACAGG + Intergenic
903002790 1:20278228-20278250 AACAGAATCATCTCTCACAAGGG - Intergenic
903006950 1:20305047-20305069 AACAAAATCCTGGCCCTCACAGG + Intronic
907811860 1:57878987-57879009 AACAAAATCCTGTCATTCACAGG - Intronic
908106262 1:60845849-60845871 AACAAAATCATGTCTTTTGCAGG + Intergenic
908416264 1:63915971-63915993 AACAGATTCATGTTTCCCAGAGG - Intronic
908980529 1:69951617-69951639 AACAAGATCATGTCTTTCACAGG + Intronic
909239349 1:73192285-73192307 AACAGAAATTTGTTTCTCACAGG - Intergenic
909772827 1:79445747-79445769 AACAAGATCATGTCCTTCACAGG + Intergenic
910306167 1:85766521-85766543 TACAGAATCAGCTCTCTCAGTGG + Intronic
916643374 1:166756455-166756477 AACAGGATCATGTCTTTTTCAGG + Intergenic
918539122 1:185608654-185608676 AACAAGATCATGTCTCTTGCAGG + Intergenic
919239669 1:194896433-194896455 AACAAAATCATGTCTTTTGCAGG - Intergenic
921702271 1:218282150-218282172 AATGGGATCATGTCTTTCACAGG + Intergenic
922045254 1:221939184-221939206 AACAGACTCATTTCTATCAGTGG - Intergenic
922854945 1:228767101-228767123 AGCAGTATCTAGTCTCTCACAGG - Intergenic
924212660 1:241786871-241786893 AACAAGATCATGTCTCTTGCAGG + Intronic
924863527 1:247952612-247952634 AACAGAAACATATTTCTCAGAGG - Intronic
1066622080 10:37366508-37366530 AACAGACTCAAGTCTTTCCCTGG - Intronic
1067773760 10:49146295-49146317 AACAGAAGCATGTTCCTCTCTGG - Intergenic
1069089817 10:64186489-64186511 AACAGAATCATTGCTCACACTGG - Intergenic
1070460563 10:76665124-76665146 CATAGAATGATGTCTCTCAGAGG + Intergenic
1070538561 10:77399112-77399134 AAAGGGATCATGTCTCTCAGTGG - Intronic
1073682619 10:105720455-105720477 AACAGAATCATCTTTGTCTCTGG - Intergenic
1073856322 10:107678885-107678907 ATCAGAATCTAGTCTCTCAAAGG - Intergenic
1077086932 11:757676-757698 AACAGAATCATGGACTTCACTGG + Intronic
1080290701 11:30667903-30667925 AGGAGACTCATGTCTCTCAAAGG + Intergenic
1082646007 11:55726478-55726500 GACAGAATCATCTCCTTCACAGG + Intergenic
1086593916 11:88548701-88548723 AATATATTAATGTCTCTCACTGG - Intronic
1087847714 11:102992191-102992213 AACAGGCTCTTCTCTCTCACTGG + Intergenic
1090428359 11:126626123-126626145 TATAGAAACATGTATCTCACAGG - Intronic
1091310534 11:134572420-134572442 AAGAGAATCGTGTCTCTCTCGGG + Intergenic
1091525965 12:1301494-1301516 AACAGGATCATGTCTTTTATAGG + Intronic
1092973125 12:13718078-13718100 AACATAATCATGTCTGTGAGAGG - Intronic
1094255073 12:28414580-28414602 AAAAGAATCATGTGACACACAGG - Intronic
1095136367 12:38609441-38609463 AACAAGATTATGTCTTTCACAGG + Intergenic
1097711028 12:62917489-62917511 AACAGAACCATGTCTCAAAATGG + Intronic
1099745418 12:86696496-86696518 AACAGAATCATATTTCTCAAAGG - Intronic
1099886471 12:88537305-88537327 AATAAAATCATGTCTTTCGCAGG + Intronic
1100210262 12:92392128-92392150 AACAGAATGAGGACTTTCACGGG + Intergenic
1100348662 12:93756928-93756950 AACTGAATCATTTCTGTCAGTGG - Intronic
1101729757 12:107417213-107417235 AACAGAACCACGTCTGCCACCGG + Intronic
1103338282 12:120206637-120206659 AACTGTATCTTGACTCTCACTGG + Intergenic
1106080233 13:26494347-26494369 GAGAGAATCAAGTCTCACACTGG + Intergenic
1111158189 13:84356182-84356204 AACAGAACCATTTCTTTCACAGG - Intergenic
1112306217 13:98276788-98276810 ACCAGAATGATACCTCTCACAGG + Intronic
1113010646 13:105761898-105761920 GACAGAAAGATCTCTCTCACGGG - Intergenic
1114537327 14:23431398-23431420 AGCAGATTCATGGCACTCACAGG + Exonic
1115517721 14:34202708-34202730 AACAGAATTCTGTCTCTGAAAGG + Intronic
1116376391 14:44207957-44207979 AACAGAAAAATGTTTATCACAGG + Intergenic
1116504968 14:45666418-45666440 AACAAGATCATGTCCTTCACAGG - Intergenic
1117202010 14:53400149-53400171 AAAAGAACCATGTATCTCAAAGG - Intergenic
1118813257 14:69290923-69290945 CCCAGAACCATGTCTCTCAAGGG - Intronic
1119907710 14:78320745-78320767 AACAAAAGCAGCTCTCTCACTGG - Intronic
1123043567 14:105500362-105500384 CACAGAACCAGGACTCTCACGGG + Intergenic
1123857610 15:24429732-24429754 AACAGAGTCATGTCTTTTACAGG - Intergenic
1124397596 15:29317995-29318017 CACCGAAACATGGCTCTCACAGG + Intronic
1127855775 15:62952671-62952693 AACTGCCTCATGTCTATCACAGG + Intergenic
1129063207 15:72878151-72878173 AACAGAAGTTTATCTCTCACAGG + Intergenic
1129748811 15:78045254-78045276 AACAGATCCATGTTTCTCAAAGG + Intronic
1130956118 15:88628628-88628650 AACAGAACCGTGCCTGTCACTGG - Intronic
1132447753 15:101941738-101941760 AACAAGATCATGTCTTTGACAGG - Intergenic
1138273345 16:55712049-55712071 AACAGAATCATGGTTCTCTTAGG + Intergenic
1138398564 16:56727435-56727457 AACAGAATCCTGTTTTTCAAAGG - Intronic
1138863267 16:60785789-60785811 AAGAGAATCATGTATTTCAATGG + Intergenic
1140149627 16:72349075-72349097 AACTGTATCTTGACTCTCACTGG + Intergenic
1145209322 17:21001626-21001648 AACAGGATCATCTGTCTCAGCGG - Exonic
1146451329 17:32976460-32976482 AACAGCTTCATGTTTCTCAAAGG + Intronic
1147479742 17:40748880-40748902 AACAAGATCATGTCTTTTACAGG + Intronic
1151152931 17:72103653-72103675 AACAACATCATCTTTCTCACGGG + Intergenic
1153077720 18:1184388-1184410 AAGAGTATCATTTCTCTCACTGG - Intergenic
1153545167 18:6197425-6197447 AACAAAATCATGTCCTTTACAGG - Intronic
1153553419 18:6285307-6285329 AACAGAGCCACGTTTCTCACTGG + Intronic
1153823038 18:8848785-8848807 AATAGACTCATGGCTCCCACAGG + Intergenic
1156150788 18:34240392-34240414 AACAAAATCATGTCTTTTGCAGG - Intergenic
1156615456 18:38778107-38778129 ATCATAATCATGTCTGTCATAGG - Intergenic
1157223769 18:45845260-45845282 AACAGAGGCATGTCTCTCTGAGG - Intergenic
1158592801 18:58791700-58791722 AACAGAATTTTGTTTCTCACAGG - Intergenic
1158915339 18:62120391-62120413 AACAGAAAAATGTCTTTCACTGG + Intronic
1160637521 19:90795-90817 AACAAGATCATGTCTTTGACAGG + Intergenic
1162236974 19:9317115-9317137 AACAGAATGAGGACTTTCACGGG - Intergenic
1162419734 19:10559299-10559321 CACACAAACATGGCTCTCACTGG - Intronic
1165083777 19:33328476-33328498 ATTAGCATCATGTCTGTCACTGG - Intergenic
1165170462 19:33888390-33888412 AAAGTAATCATGTATCTCACGGG - Intergenic
1165686109 19:37821445-37821467 AACAGGATCCAGTTTCTCACAGG + Intergenic
1166989857 19:46685623-46685645 AAAGGAATCATGGTTCTCACAGG - Intronic
1167564545 19:50248256-50248278 AACTGAATCAAGTCACTCCCTGG - Intronic
925751299 2:7092046-7092068 AAGAGGATCATCTTTCTCACTGG - Intergenic
926498223 2:13618065-13618087 AACAAAATGATGTTTCTCACTGG + Intergenic
930877628 2:56236929-56236951 AACAGAATCATCATTCTTACAGG - Intronic
931606246 2:64055532-64055554 CACACAAACATGTCTATCACAGG - Intergenic
932719647 2:74129744-74129766 AACAGACTCCTGCCTCTCTCTGG - Intergenic
933758105 2:85656400-85656422 AAGAGAAGCCTGCCTCTCACAGG - Intergenic
935877619 2:107528549-107528571 AACACAATCATGTCTTTTGCAGG + Intergenic
937021916 2:118665070-118665092 TGAAGAATCATGTCTCTCACTGG + Intergenic
942483674 2:176417010-176417032 CACAGAATCATAGCTCTCAGTGG - Intergenic
942511954 2:176711921-176711943 GACAGAATTCTGTCTTTCACAGG - Intergenic
946507406 2:220316826-220316848 ACCAGAAGAATGTGTCTCACAGG - Intergenic
947138957 2:227003199-227003221 CACAGAATTATGATTCTCACAGG - Exonic
1170382550 20:15777424-15777446 AAAAAAAACATGTCTCTCAGTGG - Intronic
1174107607 20:48173866-48173888 GACAGAAGCATGTCCCTCTCTGG + Intergenic
1174461739 20:50687997-50688019 AATATAATCATTTCACTCACAGG + Intronic
1177855256 21:26393673-26393695 TACAGTATCATTTCTCTCTCAGG - Intergenic
1178756624 21:35356273-35356295 AAAAGAATCAAGTCTGTCACAGG - Intronic
1179098716 21:38337819-38337841 AACACAATCATGCCCCTCCCAGG - Intergenic
1181002180 22:19993001-19993023 AAAACAATCATGTATCTCCCTGG + Intronic
1181185388 22:21099734-21099756 AATATAAGTATGTCTCTCACTGG - Intergenic
1181320863 22:22005024-22005046 AACTCCATCATGTCTCTCCCTGG - Intergenic
1183111927 22:35656497-35656519 AACAGAATCAGCCCTCTCCCTGG - Intronic
1184566857 22:45297237-45297259 AACAGAAATTTCTCTCTCACAGG - Intergenic
1184903717 22:47464610-47464632 AACAGGTTCATGTCTCCCAGAGG + Intronic
949395866 3:3614232-3614254 TACAAAATCATTTCTTTCACGGG - Intergenic
949813066 3:8028596-8028618 AACAAAATCTTGTTTCTCCCAGG - Intergenic
950981005 3:17304300-17304322 GACAAAATCCTGTCTCTCACTGG + Intronic
952773099 3:37020053-37020075 AACAGAATTACCTATCTCACAGG - Intronic
953395453 3:42565775-42565797 AACAGAATTCGTTCTCTCACAGG - Intronic
953828204 3:46272454-46272476 AACTTAATCATTTCTCTCATGGG - Intergenic
954532189 3:51330583-51330605 AACAGGAACCTGTCTCTCAAAGG - Intronic
954944546 3:54408633-54408655 AACAGAATGAGAGCTCTCACTGG - Intronic
957020237 3:75118424-75118446 ATGAGAATCTTGTCTCTCAGGGG + Intergenic
958523420 3:95221508-95221530 AACATAATCATGTCTTTTGCAGG - Intergenic
959429243 3:106232192-106232214 AATACAATCATGTCTTTCTCAGG - Intergenic
963266796 3:143247869-143247891 AACTGTATCATGTTTCTTACTGG - Intergenic
963313288 3:143731630-143731652 AAGAGAATCATGTTTGTCACGGG - Intronic
964674511 3:159262681-159262703 AAAAGAAACATGACACTCACGGG - Exonic
965164197 3:165173939-165173961 AACATAAACGTCTCTCTCACTGG + Intergenic
966579088 3:181539391-181539413 AACAGGATCATGTCTTTTGCAGG + Intergenic
967716896 3:192772799-192772821 AACAGAATGATGTTTGTCTCTGG + Intergenic
969966828 4:11005178-11005200 AACAGATTTTTGTTTCTCACTGG + Intergenic
972294509 4:37723802-37723824 AGCAGAGTCTTGTTTCTCACGGG - Intergenic
973702258 4:53548853-53548875 AACAAGATCATGTCTTTCACAGG + Intronic
977605449 4:98980317-98980339 AACAAAATAATATCTCTCACTGG + Intergenic
978203521 4:106051180-106051202 AACAGAATCATGTCTCTCACTGG + Intronic
978980551 4:114940164-114940186 ATTAGAATAATGTCTCTTACAGG + Intronic
979279752 4:118852550-118852572 AACAGTATCATGTCTTTTGCAGG + Intronic
979549870 4:121978611-121978633 AACAGACTCCTTTCTCTCATGGG + Intergenic
979680341 4:123452852-123452874 AACAGAAGCAGCTCTTTCACTGG + Intergenic
979706767 4:123729336-123729358 AACAGAATCATGTGTTTTGCAGG - Intergenic
981515963 4:145610289-145610311 AACAGTAGCATCTATCTCACAGG + Intergenic
982957228 4:161786473-161786495 TACAGAACAATGTCTCTCAAAGG - Intronic
983497328 4:168458482-168458504 AACAACATCATGTCCTTCACAGG + Intronic
984718337 4:182946637-182946659 AACAGAATAATGTCTGTCATTGG - Intergenic
984814351 4:183822784-183822806 AATACAATCATGTATATCACAGG - Intergenic
986197941 5:5555110-5555132 AACAAAATCATGTCTTTTGCAGG - Intergenic
987364175 5:17133991-17134013 AACAGATTCATGACTGCCACAGG - Intronic
988393816 5:30670601-30670623 AACAGAAGCATGTATATAACTGG + Intergenic
989281239 5:39646059-39646081 AAAAGAAACATGGGTCTCACAGG + Intergenic
990133594 5:52618452-52618474 AAAAGAATAATGTCTAGCACAGG + Intergenic
990357286 5:54981996-54982018 AACAGATTTGTTTCTCTCACGGG - Exonic
991654190 5:68886535-68886557 AACAAGATCATGTCTTTTACAGG - Intergenic
992572278 5:78071237-78071259 AACAAGATCATGTCCTTCACAGG + Intronic
993702233 5:91132151-91132173 GACAGATTCTTGACTCTCACTGG + Intronic
993903572 5:93600550-93600572 AAAATATGCATGTCTCTCACTGG + Intergenic
994391415 5:99197002-99197024 AATATGATCATCTCTCTCACTGG + Intergenic
994411603 5:99413338-99413360 AACGGAATCATCTCTCCCAAAGG + Intergenic
994482223 5:100351912-100351934 AACGGAATCATCTCTCCCAAAGG - Intergenic
994689925 5:103005421-103005443 AACAGAAATTTGTTTCTCACAGG + Intronic
994789697 5:104207496-104207518 AACAGAGCCATCTGTCTCACTGG + Intergenic
999052639 5:148540049-148540071 AACAAAATCATGTCTTTTGCAGG + Intronic
1000383392 5:160649256-160649278 CACAGAGTCCTCTCTCTCACAGG - Exonic
1000706928 5:164523970-164523992 AACAAACTCAGGTCTCCCACTGG + Intergenic
1004819526 6:19352203-19352225 TACAAAATAATGTCTCTCTCTGG + Intergenic
1005752498 6:28896509-28896531 AACTGGATCAAGTCTCTTACGGG + Intergenic
1007741338 6:44011472-44011494 AACAGAGGCATGTCCCTCCCAGG + Intergenic
1008540939 6:52546002-52546024 AACAGAATCATCATTCTCACAGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009706232 6:67255897-67255919 AACAGATACATTTGTCTCACAGG - Intergenic
1011152871 6:84293834-84293856 AAGAGAATCATGGTTCTCAGGGG - Intergenic
1012711917 6:102617570-102617592 ATGGGAATCATGTCTCTCAGGGG + Intergenic
1014727599 6:124991152-124991174 AACAGAGTCATGGATCACACAGG - Intronic
1014837895 6:126181449-126181471 AACAGAAACTTCTCTATCACTGG - Intergenic
1017764181 6:157593421-157593443 AATAAAATCATGTCTCCCCCAGG + Intronic
1021088824 7:16456434-16456456 AACAAAATCATGTCTTTTGCAGG - Intergenic
1022124668 7:27343860-27343882 AACAAAATCAGGGCTCTCTCAGG + Intergenic
1024747023 7:52419732-52419754 AAGAGAAAAATGTCTCTCTCAGG - Intergenic
1026068177 7:67094156-67094178 AACAAAATCATGTCCTTTACAGG - Intronic
1026391660 7:69908850-69908872 TACAGAATAATGTTTCTCAAAGG + Intronic
1026708743 7:72718152-72718174 AACAAAATCATGTCCTTTACAGG + Intronic
1027725835 7:81804947-81804969 AAGTGCATCGTGTCTCTCACAGG - Intergenic
1028042121 7:86065854-86065876 AACAGAATCATGTCTGTAAATGG - Intergenic
1028218268 7:88162162-88162184 AACAAGATCATGTCCTTCACAGG + Intronic
1028748535 7:94355551-94355573 CTCAGGATCATGTTTCTCACAGG + Intergenic
1034151535 7:148920496-148920518 AACAGCATCATGGCTGTCACCGG + Intergenic
1041158813 8:55016586-55016608 TACATAATCATTGCTCTCACTGG - Intergenic
1043877513 8:85502522-85502544 AAGAGATCCATGTCTATCACAGG - Intergenic
1043912731 8:85881808-85881830 AAGGGAAGCATATCTCTCACTGG + Intergenic
1044426151 8:92052861-92052883 AACAGATTAAAGACTCTCACAGG - Intronic
1046167287 8:110453036-110453058 AGAAGAATAATGTTTCTCACAGG + Intergenic
1047450200 8:124958608-124958630 AACAGATTAATGTTTCTCAAGGG + Intergenic
1049135492 8:140894321-140894343 AACAGAAACTTATTTCTCACTGG - Intronic
1050522000 9:6510754-6510776 AACCCATTCTTGTCTCTCACAGG - Intergenic
1050599666 9:7237820-7237842 AACAAGATAATGTCTCTCTCTGG + Intergenic
1052493667 9:29198697-29198719 TACAGAATCTTGCCTCTCCCAGG - Intergenic
1052528806 9:29655924-29655946 AACTGACTCATGGCTCTTACTGG + Intergenic
1056169306 9:83967489-83967511 AACAGAATAATGTCTTTTAAGGG - Intergenic
1056751487 9:89354828-89354850 ATCAGATGCATCTCTCTCACTGG - Intronic
1057330635 9:94111517-94111539 AACAAAATCCTGTTTCTCAGTGG + Intergenic
1057906446 9:98987217-98987239 AAAACAATCATGTCTTCCACTGG + Intronic
1058151514 9:101468640-101468662 AACAGAATCTAGTCTCCCAGGGG - Intergenic
1059907859 9:119008313-119008335 ATGAGAATCATGCCTCTCCCTGG + Intergenic
1059912608 9:119062578-119062600 AACAGGATCATGTCTTTCATGGG - Intergenic
1185973820 X:4695675-4695697 GACAGAATCATGTCTGCCTCTGG - Intergenic
1186321651 X:8433184-8433206 AACAGCATCATGCCTAGCACTGG - Intergenic
1189867172 X:45342922-45342944 CACTGCTTCATGTCTCTCACTGG - Intergenic
1192129114 X:68531091-68531113 AAAAGAATCATTCCTCTCGCTGG - Intronic
1192150768 X:68710972-68710994 AGCAGAACCATGTTCCTCACAGG + Intronic
1192265828 X:69537462-69537484 AACCAGATCATGTCTCTCCCTGG + Intergenic
1196521847 X:116683026-116683048 AACAAGATCATGTCCTTCACAGG - Intergenic
1197260155 X:124308782-124308804 AACAGAAGCCTCTTTCTCACAGG - Intronic
1198101208 X:133423410-133423432 AACAAAATCCTGTCTCTCATGGG + Intergenic
1199419454 X:147627390-147627412 AACAAAATCATCACTATCACAGG - Intergenic
1201522956 Y:14897144-14897166 AAGAGGATCATGTCTCTTCCTGG + Intergenic