ID: 978205547

View in Genome Browser
Species Human (GRCh38)
Location 4:106076396-106076418
Sequence CAGCAACAGCAGCAGTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 1, 2: 0, 3: 59, 4: 357}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978205547 Original CRISPR CAGCAACAGCAGCAGTATTG TGG Intronic
901175581 1:7296452-7296474 CAGGAACTTCAGCAGTAGTGGGG + Intronic
901519574 1:9772887-9772909 CAGCAACACCAGCAGTACCTAGG + Intronic
902581759 1:17412175-17412197 CAGGAAGAGCAGCATCATTGTGG - Exonic
902857460 1:19219226-19219248 CAGCTACAGCTGCAGTTTGGTGG - Exonic
904439838 1:30523064-30523086 CAGGAACAGCAGGAGAATTTGGG - Intergenic
904947093 1:34207239-34207261 CTGCCACAGCAGCAGTTCTGCGG + Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905534398 1:38708949-38708971 GAGCAGCAGCAGCAGCATCGCGG - Intergenic
905776394 1:40670042-40670064 CACCAACAGCAGCTGAATTCAGG - Intergenic
905805730 1:40875904-40875926 CAGCAGCAGCAGCAATGTGGAGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906296970 1:44654874-44654896 CAGCAACAGGCGCAGCATGGCGG + Exonic
906598762 1:47105199-47105221 CAGCCACAGCAGCTGTGGTGGGG + Intronic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907146354 1:52236194-52236216 TAGTAAAAGCAGCAGGATTGAGG - Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
909992412 1:82239705-82239727 GAGGGACAGCTGCAGTATTGTGG - Intergenic
912318976 1:108692661-108692683 CAGCAACAGCAGCAGTGCGGCGG + Exonic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
914513704 1:148355486-148355508 CAGCAACAACAGCAGTGTTCTGG - Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915837909 1:159192627-159192649 CAGCATCAGCATCAGCAATGTGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916591705 1:166197340-166197362 AAGCAACAGCAGCAATAGAGTGG + Intergenic
917820237 1:178755340-178755362 CACCACCAGCAGGAGTAGTGAGG - Intronic
917894278 1:179472806-179472828 CAGCCACACCAGCTTTATTGTGG + Intronic
918013653 1:180611224-180611246 CAGCAACAGCAGCAAATATGTGG + Intergenic
919338177 1:196266948-196266970 CAGCAGCAGGAGCATTTTTGTGG - Intronic
919549457 1:198966397-198966419 AAGCATCAGCTGTAGTATTGTGG + Intergenic
919653540 1:200175028-200175050 CAGCAACAGTAGCAGAAATAAGG - Exonic
919790670 1:201288827-201288849 CTGAAAGAGCAGCAGGATTGTGG + Intronic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921739257 1:218665365-218665387 CAGCAACAGCAGCTGAGCTGTGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922030698 1:221794724-221794746 CAGCAACAGGAGCTGAACTGGGG - Intergenic
922807884 1:228400032-228400054 CAGCCACATCTGCAGCATTGTGG + Intronic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923633909 1:235675399-235675421 CAGCAACAGGAGCTGTGTTAGGG + Intronic
924370984 1:243349385-243349407 CTGCAACAACAGCAGAGTTGAGG + Intronic
1064893960 10:20212244-20212266 CAGCAAGACCAGTGGTATTGTGG + Intronic
1065318746 10:24489138-24489160 CAGTAACAACTGCAGTATTCTGG - Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066313676 10:34222516-34222538 CAGCAACAGCAGAAGCTTTCTGG + Intronic
1066692433 10:38043605-38043627 CAACAACTCCACCAGTATTGTGG + Intronic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1074524876 10:114254507-114254529 CAGTAACAGCAGCAATGTGGAGG - Intronic
1074722673 10:116276182-116276204 CATAAGCAGCAGCAGTACTGGGG + Intergenic
1075233933 10:120709660-120709682 AAGCACCAGCAGCTGTAGTGAGG - Intergenic
1075263407 10:120981461-120981483 CAGATACCGCAGCAGTAGTGTGG + Intergenic
1076549717 10:131270619-131270641 CAGCAACGGCAGCAGCCATGCGG - Intronic
1076587668 10:131560428-131560450 CAGCAACAGCCGCAGGGTTGAGG - Intergenic
1079113918 11:17628210-17628232 CAGCAAAAGCAGCACTAAGGGGG - Intronic
1079399280 11:20092825-20092847 CAACAACAGCAGCAGCATCATGG - Intronic
1079542007 11:21587837-21587859 GAGAAATAGCAGCATTATTGGGG + Intergenic
1082567646 11:54700165-54700187 AAGCATCAGCTGTAGTATTGTGG + Intergenic
1083564888 11:63705488-63705510 CACCAACAGCAACAAAATTGTGG + Intronic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1084144629 11:67258159-67258181 CAGCAGCAGCAGCAGAACTAGGG + Intergenic
1084972601 11:72780112-72780134 CAGCAACATCAGATGTGTTGGGG + Intronic
1085751489 11:79166123-79166145 CACCGCCAGCAGCAGTGTTGTGG + Intronic
1086853800 11:91842571-91842593 CAGCAAAGGCAGCAGTGTGGAGG - Intergenic
1086917253 11:92545117-92545139 CAGGAACAGCAACAGCCTTGGGG - Intronic
1086980079 11:93186939-93186961 CAGCAACATCAGCAGCACTGGGG - Intronic
1087376304 11:97346227-97346249 AAGCAAATGCATCAGTATTGTGG - Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1088140636 11:106611867-106611889 CTGCAGCAGAAGCATTATTGTGG - Intergenic
1089335319 11:117718912-117718934 TAGCCACAGCAGCAGAGTTGAGG - Intronic
1089835275 11:121365037-121365059 TTGGAACAGCAGCAGTATAGAGG + Intergenic
1090105573 11:123851314-123851336 CAGCAGCAGCAGCTGTGTTGGGG + Intergenic
1092257794 12:6936759-6936781 CAGCAGCAGCAGCAGCATCACGG + Exonic
1092325501 12:7527470-7527492 GAGGAGCAGCTGCAGTATTGTGG - Intergenic
1093166162 12:15806333-15806355 CAGCAAAAGCAGCAGTAAAAGGG + Intronic
1094448949 12:30563501-30563523 CAGCAAAAGCAGTAGTAAGGAGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094783267 12:33817920-33817942 CAGCAACTGCAGCAGTGTGGTGG + Intergenic
1096111829 12:49033420-49033442 CAGCAACAGCAGCAGGGTCCTGG - Exonic
1096111863 12:49033642-49033664 CAGCAACAGCAACATTCTGGTGG - Exonic
1097195676 12:57241364-57241386 CCCCACCAGCAGCAGTGTTGGGG - Intergenic
1097234551 12:57530361-57530383 CAGCCACAGAAGCTGTGTTGGGG + Exonic
1097633786 12:62097063-62097085 AAGAAACAGAAGCAGAATTGTGG - Intronic
1098701404 12:73632410-73632432 CAGCAACAACAGCATTATCTGGG + Intergenic
1099621719 12:85009673-85009695 CAGCAACGACTGTAGTATTGGGG + Intergenic
1099882519 12:88483909-88483931 CAGCAAAAGCAGTAGTAAGGGGG + Intergenic
1100270825 12:93023004-93023026 CAGCAACATGAGCATTACTGGGG + Intergenic
1101740466 12:107495987-107496009 CAGCAACAGTGGCAGAATTGAGG - Intronic
1102491202 12:113290550-113290572 CAGCTGCAGCAGCAGTGGTGTGG - Intronic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104921252 12:132291891-132291913 CCGCAAGTGCAGCAGGATTGGGG - Intronic
1106063330 13:26317784-26317806 CAGCAAAAGCAGTAGTAAGGGGG + Intronic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106126680 13:26905633-26905655 CTGAAATAGCAGCAGTAATGAGG + Intergenic
1107702007 13:43058243-43058265 CATCAGCTGCAGCAGTATGGGGG + Intronic
1107920012 13:45196783-45196805 CTCCAACAGCAACAGCATTGGGG - Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1109495633 13:63168154-63168176 CAGCAGCAGCAGCAGCATCAGGG + Intergenic
1110835925 13:80082914-80082936 CTGCAAAAGCAGCATTGTTGAGG - Intergenic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1112655716 13:101450840-101450862 CAGCAACATCAGCATCATTTGGG - Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1114016362 14:18433310-18433332 CAGAAGCAGTAGCAGTATTCTGG + Intergenic
1114024424 14:18511968-18511990 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1115754285 14:36517693-36517715 CAGCAACTGCAGCAGGACAGCGG - Exonic
1115888579 14:38001817-38001839 CAGCAACAGCAGCATTAGCTGGG - Intronic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116913672 14:50499354-50499376 AAGGAATAGAAGCAGTATTGGGG + Intronic
1117125712 14:52622726-52622748 CAAGTACAGCAGCTGTATTGAGG - Intronic
1117547083 14:56802294-56802316 CAGCAACAACAGCAGAATGGAGG - Exonic
1118038797 14:61895662-61895684 CAGCAGCAGCATCAGTGGTGTGG - Intergenic
1118329251 14:64802967-64802989 CAACAATAGCAGCAGAGTTGGGG - Intronic
1118378565 14:65198696-65198718 GAGCAGCAGCATCAGTTTTGGGG + Intergenic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1126752247 15:51888389-51888411 CAGCCACAGCAGGAGTCTTACGG + Intronic
1127404809 15:58631517-58631539 CAGCAGCAGCAGCATTATGTGGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127793540 15:62419388-62419410 CAGCACCAACAGCTGTCTTGTGG - Intronic
1129564988 15:76612209-76612231 CAGCAGCAGCAGCAGCTTTTTGG - Intronic
1130410119 15:83640051-83640073 CTGCAGCAGCAACAGTCTTGTGG + Intergenic
1130555130 15:84917355-84917377 CAGCAACAGCAGGTGCCTTGGGG - Intronic
1131618442 15:94041653-94041675 CAGAAAGAGCAGAAATATTGAGG + Intergenic
1131902241 15:97100379-97100401 CAGCAACAGTAGCAGCACTTTGG - Intergenic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133330275 16:4968644-4968666 GTGCACCAGCAGCAGTACTGTGG + Intronic
1133337832 16:5017649-5017671 CAGAAGCCGCAGCAGGATTGGGG + Exonic
1133771042 16:8867425-8867447 CACCATCAGCCGCACTATTGTGG - Intronic
1134336151 16:13301398-13301420 CAGCAACAGCAGCATTATGTGGG - Intergenic
1134743923 16:16572790-16572812 TAGCAACAGCAGCAGTATGCTGG - Intergenic
1135001559 16:18780961-18780983 TAGCAACAGCAGCAGTATGCTGG + Intergenic
1135397869 16:22145003-22145025 CAGAACCATCATCAGTATTGGGG - Intronic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1139878221 16:70163506-70163528 CTGCCACAGCAGCAGTGGTGGGG - Intergenic
1140359342 16:74331306-74331328 CTGCCACAGCAGCAGTGGTGGGG + Intergenic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1143745437 17:8990678-8990700 CACCAACATCAGCAGGATTTAGG + Intergenic
1143942536 17:10557499-10557521 AAGAAAAAGCAGCAGTTTTGAGG - Intergenic
1144438290 17:15260710-15260732 CAGCAACAGGAGGAGCATTCTGG + Exonic
1144953527 17:19006083-19006105 CATCAACTGCAGAAGTGTTGGGG - Intronic
1145276998 17:21437505-21437527 CAGCAGCAGGAGCAGGGTTGAGG - Intergenic
1145819287 17:27818975-27818997 CAGCAACAGCTGAAAAATTGAGG + Intronic
1146672404 17:34750555-34750577 CAGCAATAGCAGTAGTAGTAGGG - Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147721594 17:42543069-42543091 CAGCACCAGCCGCAGTTCTGGGG + Exonic
1148890627 17:50804784-50804806 CAAAAAAAGAAGCAGTATTGCGG - Intergenic
1149015253 17:51901493-51901515 CAGCAACTGCAGCAGCATCATGG + Intronic
1150930245 17:69576901-69576923 CAGCAACAGTGCCAGGATTGAGG - Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1152821960 17:82441931-82441953 CAGCAACAGCAGCAGTTCTCAGG - Intronic
1203156451 17_GL000205v2_random:8425-8447 CAGAACCAGCAGCAGTGTTCTGG + Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1155707030 18:28828662-28828684 CAGCAACAGTAGCAGGATTTTGG - Intergenic
1156112676 18:33746281-33746303 CAGCAACAACAGCAGCTCTGTGG + Exonic
1156156560 18:34309588-34309610 CAGCAATAGCAGCAAGATGGTGG - Intergenic
1156637861 18:39052640-39052662 CAGCAGCAGCAGCAGAAATTGGG + Intergenic
1158476702 18:57786482-57786504 CAGCAACATCAGCATGACTGGGG - Intronic
1159039365 18:63309199-63309221 CAGCATCAGCAGTAGCATTTAGG + Intronic
1159103595 18:63981326-63981348 CAGCACCAACTACAGTATTGTGG - Intronic
1159244452 18:65787320-65787342 CAGCAACAGAAGCAATAATTTGG - Intronic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160304646 18:77720609-77720631 AAGCAACACCAGCAATTTTGTGG - Intergenic
1160800941 19:968454-968476 CAGCAACAGCATCAGCATGTCGG + Exonic
1160859758 19:1232795-1232817 CCTCAACAGCAGCAGAGTTGTGG + Intronic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165367635 19:35378538-35378560 GAGCTACAGCAGCCATATTGGGG + Intergenic
1166064851 19:40351611-40351633 CAGCAAAAGCAAAAGTCTTGCGG + Intronic
1167362221 19:49036286-49036308 CAGCAACAGCAGCAGCCTCTGGG + Exonic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1168447243 19:56430703-56430725 CAGAAACAGCAACAGTAGTCAGG + Intronic
1202634646 1_KI270706v1_random:34522-34544 TAGCGACAGCAGCAGTCTTCAGG + Intergenic
925404600 2:3597801-3597823 CTGCCTCAGCAGCAGTATTTTGG - Intronic
925694677 2:6563418-6563440 CAGTATCAGCAGCAGTGCTGGGG - Intergenic
926192088 2:10735969-10735991 CAGCAACACCAGCATCACTGGGG - Intronic
926203004 2:10814579-10814601 CAGCAACAGCAGCAAATTTAAGG - Intronic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
927043688 2:19255656-19255678 GAGCAGCAGCAGCAGGATTGTGG + Intergenic
927199301 2:20568504-20568526 CAGCAACAGGATCAGACTTGTGG + Intronic
929465863 2:42143202-42143224 CAGAAAAAGCAGCAGCAATGAGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
930459933 2:51660529-51660551 CAACAACAGCAGCTATATTTTGG + Intergenic
930857068 2:56030251-56030273 CAACAACATCAGCAGTTTTGGGG - Intergenic
931046811 2:58363076-58363098 CAGCAAAAGCAGCAGCAATTGGG - Intergenic
932086215 2:68764709-68764731 GAGGAACAGCAGCAGCATGGAGG - Intronic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
936539462 2:113338301-113338323 CAGACACAGCAGCAGGACTGGGG - Intergenic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
936848406 2:116866655-116866677 CTGCAAGAGCAGCAGATTTGGGG + Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
937630165 2:124092365-124092387 CAGCAGCAACAACAGTAATGGGG - Intronic
937992771 2:127673683-127673705 CAGCCCCAGCAGCAGCATTGAGG - Intronic
938854847 2:135298975-135298997 CATCAGCTGCAGCAGTATAGGGG + Intronic
940031023 2:149261418-149261440 CAGCAGCAACAGCAGTAGTTTGG + Intergenic
940276204 2:151943287-151943309 CAGAACCAGCAGCACTATTGGGG - Intronic
940962208 2:159798157-159798179 CAGCAACGGCAGCAGGAGCGCGG + Exonic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
942467524 2:176224362-176224384 CAGTCACAGAAGCAGAATTGAGG + Intergenic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
943511230 2:188830233-188830255 CAGCCACAGCAGGAGTGGTGAGG - Intergenic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
947128390 2:226895802-226895824 CAGCAACAGCAAAACTATTTAGG + Intronic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
947967028 2:234290395-234290417 CAGGAACAGCAGGAGGTTTGAGG - Intergenic
948731116 2:239964294-239964316 AAGCAACAGCCACAGTAATGTGG + Intronic
948871044 2:240798281-240798303 TAGCCACATCAGCAGTAGTGTGG + Intronic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169778929 20:9288004-9288026 CAGCTCCACCAGCAGGATTGTGG + Intronic
1169829730 20:9811013-9811035 CAGCAATAGAAGCAGTATAATGG + Intronic
1170088672 20:12566292-12566314 CAGACACAGCAGCTGTGTTGGGG - Intergenic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174063706 20:47849889-47849911 CAGCAACAGTGTCAGGATTGGGG + Intergenic
1175443530 20:59006351-59006373 CAGCAGGAGCCGCAGTATTGGGG + Exonic
1175446611 20:59024432-59024454 CAGGAACAGCAGCTGCTTTGTGG + Exonic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176646865 21:9360291-9360313 TAGCGACAGCAGCAGTCTTCAGG + Intergenic
1177174401 21:17689037-17689059 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1177534786 21:22410294-22410316 CAGCAACAGCAGCTGTAACCTGG + Intergenic
1178728062 21:35072773-35072795 CAACAGCAGCAGCAGTGTGGTGG + Intronic
1179199162 21:39199405-39199427 TAGCTACAGCAGAAGCATTGCGG + Exonic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1180366060 22:11938706-11938728 TAGCGACAGCAGCAGTCTTCAGG - Intergenic
1180440869 22:15364183-15364205 CAGAAGCAGTAGCAGTATTCTGG + Intergenic
1180448590 22:15439495-15439517 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1180761448 22:18211600-18211622 TTTCAGCAGCAGCAGTATTGCGG - Intergenic
1180774219 22:18413010-18413032 TTTCAGCAGCAGCAGTATTGCGG + Intergenic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181027420 22:20134037-20134059 CGGCGACACCAGCAGTCTTGAGG + Intronic
1181070330 22:20332017-20332039 TTTCAGCAGCAGCAGTATTGCGG + Intergenic
1181193320 22:21159962-21159984 TTTCAGCAGCAGCAGTATTGCGG + Intergenic
1181216123 22:21332638-21332660 TTTCAGCAGCAGCAGTATTGCGG - Intergenic
1181393678 22:22602714-22602736 CAGCCAAAGCAGGAATATTGAGG + Intergenic
1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG + Intronic
1181572026 22:23772920-23772942 GAGCAGCAGCAGCAGCATCGGGG - Exonic
1181817198 22:25447517-25447539 GAGAAAAAGCAGCAGTAGTGTGG - Intergenic
1182715212 22:32352685-32352707 CAGCAGCAGCAGCAAGTTTGGGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
952627508 3:35424763-35424785 CAGCAAAAGCAGCAGCAATTGGG + Intergenic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953087996 3:39691981-39692003 CAGCAAGAGCAGCAGTAAGAGGG + Intergenic
953934412 3:47027756-47027778 CAGCAGCAGCAACTTTATTGAGG - Intronic
955043366 3:55337512-55337534 TGGCAACAGCAGCAATATGGTGG + Intergenic
955522314 3:59786812-59786834 CAGGAACAGCTGGAGTATTGAGG - Intronic
956135323 3:66092786-66092808 CAGGAACAGCGGCAGAATTGTGG + Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
956689641 3:71863955-71863977 CAACAACAGCAGCAGGCTAGGGG + Intergenic
956900935 3:73715411-73715433 CCTCAACAGCAGCAGTATTTGGG - Intergenic
957648397 3:82965951-82965973 CACCAACAGCATTAATATTGTGG - Intergenic
958659205 3:97043543-97043565 CTGCAGAAGCAGCAGTGTTGTGG + Intronic
958775923 3:98482938-98482960 CATCAACTGCAGTAGTATAGGGG + Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
966159525 3:176953315-176953337 CACCAACATCATCAGTATTAAGG + Intergenic
1202740021 3_GL000221v1_random:44749-44771 TAGCGACAGCAGCAGTCTTCAGG - Intergenic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
970131121 4:12872670-12872692 CAGCAACTCCAGGAGTCTTGAGG - Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
972083431 4:35182705-35182727 CAGCAGCAGTAGCAGTGTGGTGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
973155208 4:46943269-46943291 CAGAAACAGCTGAAGTTTTGTGG - Intronic
973575862 4:52288721-52288743 CAGCAACATCAGCATTATTTGGG - Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974386931 4:61213108-61213130 CAACAACAACAGAAGTAATGGGG + Intronic
974951002 4:68582750-68582772 AAGCATCAGCTGTAGTATTGTGG - Intronic
975165212 4:71170738-71170760 CAACACCATCACCAGTATTGAGG - Intergenic
976911272 4:90309175-90309197 TTGTAACAGCAGCAGAATTGAGG - Exonic
977447529 4:97149624-97149646 CAGAAACAGAAACAGTAGTGAGG - Intergenic
977814351 4:101397115-101397137 CAGTAACAGCAGCAGTGCTCAGG - Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978329291 4:107594885-107594907 CACCAACAGCAGCAGGCTTTCGG - Intronic
979055447 4:115987492-115987514 CAGGAACAGAACCAGTAGTGAGG + Intergenic
980532149 4:134070303-134070325 CAGCAGCAGCGGCAGTGTGGTGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981354705 4:143774723-143774745 GAGCAACAGCAGCAGAAGTTTGG + Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981633489 4:146848809-146848831 CAGGAACAGGAGCAGTCCTGGGG - Intronic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
1202761653 4_GL000008v2_random:117895-117917 TAGCGACAGCAGCAGTCTTCAGG + Intergenic
985482474 5:124003-124025 CAGCAAAAGCAGCATTAAGGGGG - Intergenic
985815553 5:2125446-2125468 TAGCAGCAGCTGGAGTATTGGGG + Intergenic
986431525 5:7685650-7685672 CAGCAACAGTAGCAGTTGTTGGG + Intronic
986989079 5:13530772-13530794 CATCAATATCAGCAGTATTGTGG - Intergenic
988815317 5:34828769-34828791 AAGCATCAGCGGCTGTATTGAGG + Intronic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
991421215 5:66444200-66444222 CACCAGCAGCAGCAGCATTAGGG + Intergenic
994422812 5:99543255-99543277 CAACAACCTCAGCAGTATTATGG + Intergenic
994604816 5:101954015-101954037 CATCAGGGGCAGCAGTATTGCGG - Intergenic
994613811 5:102078429-102078451 CCCCAGCAGCAGCAGTATTGTGG - Intergenic
994657129 5:102607786-102607808 CAGCAACATCAGCACCACTGGGG - Intergenic
994998937 5:107102677-107102699 CAGTTCCAGCAGAAGTATTGGGG - Intergenic
995963374 5:117873008-117873030 CAGCAACAGCAGCAGTTCAGAGG + Intergenic
996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG + Intergenic
997160810 5:131607398-131607420 CAGCTTCAGCAGCAATATTATGG - Intronic
997182166 5:131841342-131841364 CAGCAGTAGCAGCAGTGTGGTGG + Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998043305 5:138967225-138967247 CAGCAGCACCAGCAGTATCTGGG + Intronic
998476615 5:142427516-142427538 CAGTAAAAGTAGCAGTATTCTGG - Intergenic
999337549 5:150735159-150735181 AAGCATCAGCTGCAGTAGTGTGG - Intronic
999866471 5:155705750-155705772 TAGCAACAGCAGCAGTGTCAAGG + Intergenic
1000804306 5:165770099-165770121 CAGCAACAGAAGCATTTTTGCGG - Intergenic
1000839786 5:166203919-166203941 CATCAGCAGCAGCAGTATTAAGG - Intergenic
1000971875 5:167723664-167723686 CAGCAGCAGCAGAGGTCTTGAGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002954618 6:1849804-1849826 CAGCAACACCATCAATATTATGG + Intronic
1003990928 6:11485751-11485773 CAACAACAACAACAGTATAGCGG + Intergenic
1005555208 6:26972576-26972598 GAGTCACAGCAGCAGGATTGAGG + Intergenic
1006193620 6:32223899-32223921 CAGCAGCAGCAGCAGTGAAGGGG + Exonic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007415914 6:41691074-41691096 CAGCAACAGCAGCAGCTCGGAGG - Exonic
1008652106 6:53574171-53574193 CTGCAACAACAGCAGTAATGTGG - Intronic
1008662581 6:53683347-53683369 CAGCAGCAGCAACAGTATCTGGG - Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1009055384 6:58328480-58328502 GAGCAATAGCAGCAGTAATAGGG - Intergenic
1009235779 6:61122102-61122124 GAGCAATAGCAGCAGTAATAGGG + Intergenic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1011973962 6:93268658-93268680 GAGCAACAGCAGTGGTATTCAGG + Intronic
1012118455 6:95334145-95334167 CAGCAACACAAGCAGTATATGGG + Intergenic
1013259447 6:108426668-108426690 CAGCACCAGCACCAGTCTTTGGG + Intronic
1013804770 6:113985045-113985067 CAGCAACAGCAGCAGCAAATGGG - Intronic
1015780302 6:136858509-136858531 AAAAAACAGCAGCAGAATTGTGG + Intronic
1016466826 6:144334211-144334233 CAGCAACAGGTGCAGCATTCCGG - Intronic
1017327082 6:153151983-153152005 CTGCAGCAGCAGCAGTACTCTGG - Intergenic
1017840905 6:158222295-158222317 CAGCAGCAGAAGCAGTCATGGGG - Intergenic
1018025870 6:159805230-159805252 CAGCGAGAGCAACAGCATTGTGG + Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022276906 7:28864051-28864073 TATCATCAGCATCAGTATTGAGG - Intergenic
1024902333 7:54334099-54334121 CAACAACAGTTGCAGTGTTGAGG + Intergenic
1024908526 7:54418576-54418598 CAGCAACAACAAAAGTCTTGGGG + Intergenic
1026681096 7:72467259-72467281 CAGCCCCACCAGCAGGATTGGGG - Intergenic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1028027049 7:85856835-85856857 ATGCAACAAAAGCAGTATTGAGG - Intergenic
1030769733 7:113459106-113459128 CAGCAAGAGAAGCAGCAATGTGG - Intergenic
1031633304 7:124070478-124070500 CAGCAGCAGAAGTAGTATTTTGG + Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033494274 7:141878060-141878082 CTGCAACAAAAGCAGTGTTGGGG - Intergenic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034454004 7:151155031-151155053 CAGCAGGAGCTGCAGTAATGGGG - Intronic
1034820977 7:154216044-154216066 CAGGAACCACAGCAGTGTTGAGG + Intronic
1038379793 8:27081811-27081833 CAGAAACAGCAGCATTATCCTGG + Intergenic
1038379835 8:27082261-27082283 CTGCAACAGCAACAGGAGTGAGG + Intergenic
1041360070 8:57043563-57043585 AACTTACAGCAGCAGTATTGAGG - Intergenic
1041429136 8:57759220-57759242 CAGCAACAGTGGCAGCATGGTGG - Intergenic
1041815262 8:61963329-61963351 CAGCAGCTAAAGCAGTATTGAGG - Intergenic
1042656020 8:71097424-71097446 AGGCAACAGCAGCAGAAATGAGG - Intergenic
1043077032 8:75715475-75715497 ATGCCACAGCAGCAGTAGTGGGG + Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1045455947 8:102379008-102379030 CAAAAAAGGCAGCAGTATTGGGG - Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1048925241 8:139265463-139265485 CAGGAAGAGCTGCAGAATTGGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1049713332 8:144077426-144077448 CAGCTGCAGCAGCAGGGTTGTGG + Intergenic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1055231761 9:74074812-74074834 CACCAACAGCTGCAGCAGTGTGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056322694 9:85451901-85451923 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1057599946 9:96449595-96449617 CAGCAAGTGCAGCAGTCTTGAGG - Intergenic
1059259498 9:112962244-112962266 CAGCAACAGCAGCATCATCTTGG + Intergenic
1059908756 9:119019436-119019458 AAGCAACAGCAGCAGTTATCTGG + Intergenic
1060040335 9:120294841-120294863 CATCAACAGCAGCAGCATTCTGG + Intergenic
1060240565 9:121898915-121898937 CAGCAACAGAAGCAGGCATGAGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062580953 9:137229021-137229043 CAGCCCCAGCAGCAGTATCTGGG - Exonic
1203708662 Un_KI270742v1:74706-74728 TAGCGACAGCAGCAGTCTTCAGG - Intergenic
1203542423 Un_KI270743v1:102776-102798 TAGCGACAGCAGCAGTCTTCAGG + Intergenic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1186974504 X:14886706-14886728 CAGCAGCATCAGCAGTATGTAGG + Intronic
1187500200 X:19833079-19833101 CAGCATCAGCTCCAGTTTTGAGG - Intronic
1187990921 X:24871349-24871371 CAGCAACATCAGCATCATTTGGG - Intronic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188835456 X:34948706-34948728 CAGCTGCTGCAGCAGCATTGCGG - Intergenic
1189152281 X:38720727-38720749 CAGGAACAGGAGCAGAATTAGGG + Intergenic
1189456521 X:41195467-41195489 CAGCAACATCAGCATTATCTGGG - Intronic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190952922 X:55163349-55163371 CAGCATCACCAGCAGGATTTGGG + Intronic
1191225741 X:58040910-58040932 CAGCAACAGTAGCAGCATGGTGG - Intergenic
1191685529 X:63885512-63885534 CAGGCACAGCAGCAGGTTTGTGG - Intergenic
1192232828 X:69277837-69277859 CAGCAGCAGCAGCAACTTTGGGG + Intergenic
1193251804 X:79299401-79299423 CAGCAACAACAACAAAATTGTGG + Intergenic
1194081023 X:89465419-89465441 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1194085685 X:89524960-89524982 CAGCAGCTGCAGCAGTGTGGCGG + Intergenic
1196415437 X:115466136-115466158 CAGCAGCAGCAAAAGTATTAAGG - Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197855914 X:130913742-130913764 TAGCAGCAGCAGCAGTAATCAGG - Intergenic
1198737284 X:139800594-139800616 CAGCAGCAGCAGCATTACTGGGG - Intronic
1198783601 X:140262741-140262763 TACCTTCAGCAGCAGTATTGAGG + Intergenic
1199490017 X:148387647-148387669 AGGCAACAGCAGCTGTATAGTGG - Intergenic
1200052230 X:153440359-153440381 CAGGAACAGTATCAGCATTGTGG - Intergenic
1200433695 Y:3121622-3121644 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1200438331 Y:3180843-3180865 CAGCAGCTGCAGCAGTGTGGCGG + Intergenic
1200656502 Y:5909444-5909466 CGCCAACAGCAGCAGTGTGGTGG + Intergenic
1200720192 Y:6597323-6597345 ATGCAGCAGCAGCAGTGTTGTGG - Intergenic
1201163323 Y:11183650-11183672 CAACCACAGCAGCAGTGTTCTGG - Intergenic