ID: 978205936

View in Genome Browser
Species Human (GRCh38)
Location 4:106081472-106081494
Sequence CACGGCCACATGGTGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978205926_978205936 22 Left 978205926 4:106081427-106081449 CCAAATATGTTCTCACTTACAAG 0: 1
1: 0
2: 15
3: 45
4: 300
Right 978205936 4:106081472-106081494 CACGGCCACATGGTGGTGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978205936 Original CRISPR CACGGCCACATGGTGGTGAG GGG Intronic
900956111 1:5887372-5887394 CAGGACAACATGGTGGTGAGTGG - Exonic
902338025 1:15765039-15765061 CACGGCCACATCGCGGCGCGGGG - Exonic
902565660 1:17309747-17309769 CAGGGCCACATGGTGGAGGCAGG + Intronic
903490420 1:23724016-23724038 CAGGGCAACATGGAGGAGAGTGG - Intergenic
904347785 1:29884617-29884639 GCAGGCCACATGGTTGTGAGAGG + Intergenic
905442925 1:38006000-38006022 CAAGGCCCTATGGTGGGGAGGGG - Intergenic
905480700 1:38260003-38260025 CAAGGTCACATGGTGGGCAGTGG - Intergenic
905486368 1:38299797-38299819 CAAGGTCCCATGGTTGTGAGTGG + Intergenic
906522848 1:46477490-46477512 CACGGGCATGTGGAGGTGAGAGG + Intergenic
907654663 1:56330084-56330106 CAGGGCCACATGATGATTAGTGG - Intergenic
910443161 1:87273598-87273620 CAGGGGCACAAGGTGGGGAGAGG - Intergenic
910838081 1:91535636-91535658 CACGGCCAGGCGGTGGCGAGCGG + Intergenic
913481894 1:119296583-119296605 CAAGGCCACCTGGTTTTGAGAGG - Intergenic
913581738 1:120233437-120233459 CACGGGACCCTGGTGGTGAGGGG - Intergenic
913626439 1:120664951-120664973 CACGGGACCCTGGTGGTGAGGGG + Intergenic
914563669 1:148844884-148844906 CACGGGACCCTGGTGGTGAGGGG - Intronic
914609158 1:149285342-149285364 CACGGGACCCTGGTGGTGAGGGG + Intergenic
917139849 1:171824974-171824996 TAAGTCCACATGGGGGTGAGGGG - Intergenic
920182072 1:204138171-204138193 CAAGGTCATATGGTGGTTAGAGG + Intronic
920298508 1:204974491-204974513 CAGGGCCACCTGGTGGCTAGAGG + Intronic
920306573 1:205022005-205022027 CATGGCCACAGGGTGCAGAGAGG + Exonic
920562505 1:206948644-206948666 CTCTGCCCCATGGTGGTGGGTGG + Intergenic
922764582 1:228150414-228150436 AGCGGCCACCTGGAGGTGAGGGG + Intronic
1062798831 10:364449-364471 GATGGCCTCATGGTGGTCAGCGG - Exonic
1066375295 10:34852676-34852698 CAAGGTCACATGGTTGTAAGTGG - Intergenic
1068639557 10:59388026-59388048 CAGGGCCACACTGTGGTCAGGGG + Intergenic
1071574942 10:86718409-86718431 TAAGGCCACATTCTGGTGAGTGG - Intronic
1072822865 10:98575316-98575338 CACGGCCATGTGGTGCTGTGTGG - Intronic
1074353263 10:112758647-112758669 CAAGGCCACAAAGTGGTGAATGG - Intronic
1074506815 10:114078118-114078140 CATGGCCACCTTGTGGTGACTGG - Intergenic
1075526440 10:123190997-123191019 CAAGGCCACATGCTGCTAAGAGG - Intergenic
1075873458 10:125787933-125787955 CAGGGTCACATGCTAGTGAGTGG - Intronic
1076182645 10:128422516-128422538 AAAGGACACATGGTGCTGAGTGG + Intergenic
1076679093 10:132162325-132162347 CACGTGCACCTGGTGGTGGGAGG - Intronic
1077343437 11:2036038-2036060 CACGGCACCTTGCTGGTGAGGGG + Intergenic
1078461098 11:11515853-11515875 CACGGCCCCATGAGGGAGAGAGG + Intronic
1078944305 11:16046565-16046587 AACAGCCACATGGTGTTGACGGG - Exonic
1079087178 11:17454751-17454773 CAAGGTCACATGCTGGTAAGGGG + Intronic
1081665470 11:44914601-44914623 CAGGGTAACATGGTGATGAGAGG + Intronic
1084618360 11:70251610-70251632 CAGGGCCACGTGGTGGGGGGGGG - Intergenic
1084674922 11:70628726-70628748 CACCGCCTCTGGGTGGTGAGGGG + Intronic
1085461539 11:76696878-76696900 GACGCCTACATGGTGGTGTGGGG - Intergenic
1087803127 11:102525687-102525709 CTCGGCCAAAGGGTGGTGGGAGG + Intronic
1202826423 11_KI270721v1_random:91227-91249 CACGGCACCTTGCTGGTGAGGGG + Intergenic
1092780796 12:11984938-11984960 GACGCTCACATGGAGGTGAGTGG + Intergenic
1097221365 12:57453081-57453103 CACTGCCACATGGTGGACACTGG + Intronic
1098529979 12:71530756-71530778 CAAAGCCACATGGAGGTGATGGG + Intronic
1102522606 12:113488012-113488034 CAGGGCCACAGGTAGGTGAGAGG + Intergenic
1104342292 12:127961717-127961739 CAGGGCCACATGGTGAAGACTGG + Intergenic
1110832114 13:80043600-80043622 CATGGCCAAGAGGTGGTGAGGGG - Intergenic
1112443949 13:99446434-99446456 CACCTCCACCTGGTGGTCAGTGG + Intergenic
1112655290 13:101445938-101445960 CAAGGCCACAGAGTGATGAGGGG - Intergenic
1112933435 13:104769909-104769931 TAAGGCCACATGGTGATGTGAGG - Intergenic
1115465336 14:33708696-33708718 CACAGACACATGGAGGTGGGGGG + Intronic
1120838744 14:89064423-89064445 CACGGAGACATGGGGGTTAGGGG - Intergenic
1126350980 15:47744550-47744572 CAAGGACACATGGTTGTGGGGGG + Intronic
1129818003 15:78573106-78573128 CATTGCCAAATGTTGGTGAGGGG - Intronic
1132270786 15:100522498-100522520 CACGGATCCATGGTGGTGACAGG - Intronic
1132774850 16:1587693-1587715 CAGGGCCACCTGGGGGTAAGGGG + Intronic
1132888142 16:2191430-2191452 CAAGGACACAGGCTGGTGAGTGG - Intronic
1136083074 16:27865429-27865451 CACTGCCACCTGGTGGGGAGTGG + Intronic
1136300048 16:29328315-29328337 GACGTCCACATGGTGGGGGGAGG + Intergenic
1136556795 16:31011625-31011647 CAGGGTCACATGCTGCTGAGAGG - Intergenic
1138518916 16:57559171-57559193 CACTGCAACATTGTGGTGGGAGG + Intronic
1139775190 16:69312156-69312178 CAAGGTCACTTGCTGGTGAGTGG - Intronic
1143010139 17:3861766-3861788 CACAGGCATATGGTGGAGAGGGG - Intronic
1143908082 17:10225779-10225801 CAAGGCCACATAGCTGTGAGTGG - Intergenic
1145901631 17:28493943-28493965 CAGGGCCACAGGGTGGAGGGTGG - Intronic
1146253800 17:31376575-31376597 AAGGGACACATAGTGGTGAGAGG - Exonic
1146533601 17:33631112-33631134 CACTGCCACATGGTGGTGGGAGG + Intronic
1147910530 17:43853399-43853421 AGGGGGCACATGGTGGTGAGGGG + Intronic
1148163729 17:45467857-45467879 CAAGGCCTTATGCTGGTGAGTGG + Intronic
1148856267 17:50580754-50580776 GAGGGCCCCATGGGGGTGAGCGG + Intronic
1150394958 17:64814510-64814532 CAAGGCCTTATGCTGGTGAGTGG + Intergenic
1152756167 17:82087953-82087975 AACGGCAACCTGGTAGTGAGTGG - Exonic
1152930875 17:83109277-83109299 CAGGGCCACATAGCTGTGAGGGG + Intergenic
1153477954 18:5517776-5517798 CCCGGCCACATGCTGCTGATGGG - Intronic
1157102473 18:44743183-44743205 ATAGGCCAGATGGTGGTGAGGGG + Intronic
1157168609 18:45381739-45381761 CAGGGGAACAGGGTGGTGAGTGG + Intronic
1160509620 18:79445910-79445932 CACGGTGACATGGTGGGTAGTGG - Intronic
1161666841 19:5582343-5582365 CGCGGTCACACGGTGGTGAAGGG - Intergenic
1162122188 19:8477886-8477908 CAAGGTCACATGCTGGTGAGAGG - Intronic
1163289689 19:16371159-16371181 CATGGGCACATGATGGGGAGAGG + Intronic
1163722769 19:18906058-18906080 CACAGCCACCTGGGGCTGAGAGG - Intronic
1166116940 19:40662220-40662242 CACGGCGGGATGGTGGGGAGGGG + Intergenic
1166377493 19:42335935-42335957 CACGGCCACATGGGAGTGACGGG - Exonic
1166536900 19:43580314-43580336 GACCACCACATGGTGGGGAGGGG + Intronic
1166997740 19:46727886-46727908 CCCGGCCACATGAAGGTAAGAGG - Exonic
1167075710 19:47247566-47247588 CACCGCCCCCTGGTGGAGAGTGG + Intergenic
928380025 2:30809742-30809764 CATGGCTACAGGTTGGTGAGTGG - Intronic
929577379 2:43060567-43060589 CAAGGTCACATGCTGGTGAGTGG + Intergenic
932257293 2:70298918-70298940 TTCGGCCCCATGGGGGTGAGTGG + Intronic
932269217 2:70394505-70394527 CATGGACACATGGTGGGGACAGG - Intergenic
932460635 2:71879718-71879740 CACTGCCCCATGCTGGGGAGGGG + Intergenic
932475451 2:72003117-72003139 CACAACCACAAGGAGGTGAGTGG + Intergenic
934553583 2:95276361-95276383 CAGGGGCACATGAGGGTGAGGGG - Intronic
935598398 2:104897543-104897565 CAAGCCCACTTAGTGGTGAGTGG + Intergenic
946921614 2:224585783-224585805 CCTGGTCACATGGTGGGGAGTGG + Intergenic
948120213 2:235523983-235524005 CCAGGTCACAGGGTGGTGAGTGG - Intronic
1169220912 20:3822230-3822252 CACGGCCGCATGGTGCCGAGAGG + Exonic
1169835191 20:9870070-9870092 CAGGGCCACATGGGGTTCAGGGG + Intergenic
1171499068 20:25579224-25579246 CAGGGTCACATGGAGGTCAGGGG - Intronic
1171505263 20:25627962-25627984 TGCTGCCACATGGTGGTGGGAGG - Intergenic
1175062854 20:56259460-56259482 AATGGCCCCATGCTGGTGAGAGG - Intergenic
1175246719 20:57586462-57586484 CAGGGCCACTGGGTGGTGTGGGG + Intergenic
1175321746 20:58093045-58093067 CATGTACCCATGGTGGTGAGAGG - Intergenic
1181803552 22:25362001-25362023 CATGGCCACATGATGTTGAGGGG - Exonic
1181938416 22:26455868-26455890 CAGGGCCACAAGGTGGTTGGTGG + Intronic
1182353234 22:29710528-29710550 CATGTCCCCATGGTGGGGAGGGG + Intergenic
1183102799 22:35594192-35594214 CACAGCGACACGGTGGTGGGTGG + Intergenic
1183308500 22:37096849-37096871 CACGGTCACACAGTGCTGAGTGG + Intronic
1184410215 22:44321980-44322002 CAAAACCACATGGTGGTGAAGGG + Intergenic
1184470075 22:44691271-44691293 CAGGGTCACAGGCTGGTGAGGGG - Intronic
950029194 3:9840690-9840712 CACAGCCACCTACTGGTGAGAGG - Exonic
950417406 3:12876290-12876312 CGGGGCCACAAGGTGGTGAGCGG - Intergenic
951334653 3:21406240-21406262 CAAGGCCAGAAGATGGTGAGTGG - Intergenic
951624212 3:24642483-24642505 CAGGGCCAAATGGTGGAAAGTGG - Intergenic
958684975 3:97380491-97380513 CAGGAACACAGGGTGGTGAGGGG + Intronic
960466508 3:118002462-118002484 CAGGGCCACACCTTGGTGAGTGG - Intergenic
961918816 3:130404689-130404711 CATGGCCACAGGTTGCTGAGAGG - Intronic
962249951 3:133829831-133829853 CATGGCCGCATGGTTGTTAGAGG - Intronic
963831885 3:150017313-150017335 CAAGGCCACAGAATGGTGAGAGG - Intronic
965608133 3:170516874-170516896 CAGAGCCACAGGGTGGTCAGTGG - Intronic
965632713 3:170749674-170749696 GAGGGCCACAGGGTGGGGAGAGG - Intronic
968473630 4:792757-792779 CAGGGCCAGATGGAGGTGGGAGG - Intronic
968974419 4:3813665-3813687 CGAGGCCACACAGTGGTGAGGGG + Intergenic
972379966 4:38510415-38510437 CACAGGCATATGGTGGTGTGGGG + Intergenic
976161680 4:82207733-82207755 CAGGGTAACATGGGGGTGAGGGG + Intergenic
977705608 4:100066998-100067020 CAAGATCACGTGGTGGTGAGTGG - Intergenic
978205936 4:106081472-106081494 CACGGCCACATGGTGGTGAGGGG + Intronic
979747700 4:124238407-124238429 AATGGCCACATGGTGCTGATGGG + Intergenic
984227305 4:177050688-177050710 CATGGCCCATTGGTGGTGAGGGG - Intergenic
984238907 4:177193752-177193774 GAAGGCCACTTGTTGGTGAGAGG - Intergenic
986323252 5:6650972-6650994 CAAGGCCACAAGCTAGTGAGTGG - Intronic
987764584 5:22208651-22208673 GAAGGCCACATGGTGGTCATTGG + Intronic
993180206 5:84542862-84542884 CACACACACATGCTGGTGAGGGG + Intergenic
995248684 5:109964568-109964590 CAAGGTCACCTGCTGGTGAGTGG - Intergenic
996780595 5:127182589-127182611 CACGGCCAAATCATGTTGAGAGG + Intergenic
999373164 5:151068555-151068577 TACTGCCACATGGAGGGGAGTGG - Intronic
1002398561 5:178977021-178977043 CACAGCCAGATGGAGGTGACAGG + Intergenic
1002922305 6:1581237-1581259 GACAGCCACAGGGTGGGGAGGGG + Intergenic
1004538199 6:16523312-16523334 CACGTGCACATGGCTGTGAGTGG + Intronic
1006844882 6:37055318-37055340 CAAGGCCTAATGATGGTGAGTGG - Intergenic
1007022195 6:38532072-38532094 CACTGCCACAGGATGGGGAGGGG - Intronic
1007588859 6:43009308-43009330 CTCTGCCACCTGGTGGGGAGAGG - Exonic
1007733858 6:43968391-43968413 CAAGGCCACATGGTAGGGGGTGG - Intergenic
1007944953 6:45817804-45817826 CAGGACCACATGCTGGTGTGTGG + Intergenic
1016447310 6:144147304-144147326 CTTGGCCACATGGAGGTCAGTGG - Intergenic
1017057550 6:150451870-150451892 TAAGGCCACTGGGTGGTGAGCGG - Intergenic
1017842370 6:158232289-158232311 CACGGCCGCCCGGAGGTGAGCGG + Intronic
1019296438 7:278172-278194 CAAGGCCTCAAGCTGGTGAGTGG + Intergenic
1019771464 7:2886284-2886306 CACGTGCACATGGTTGTGAGTGG + Intergenic
1020104789 7:5417718-5417740 AAGGGCCACTTGGTGGGGAGGGG - Intronic
1020525795 7:9256833-9256855 CAGGGCCAGATGGGGGTGGGAGG + Intergenic
1021992472 7:26152011-26152033 CACGGCCACAGGGTGGCAAGGGG + Intergenic
1022718611 7:32922154-32922176 CACATCCAGATGGTGCTGAGAGG - Intergenic
1024042902 7:45568732-45568754 CACAGTCACATGGAGGTGAATGG + Intergenic
1024527440 7:50360805-50360827 CAGAGCCACATGGTGATGACTGG - Intronic
1028963131 7:96772000-96772022 CACGGCTTCATTGTGGTTAGAGG + Intergenic
1029111285 7:98214149-98214171 CAGGGCCACCTGGTGGGGACGGG - Intergenic
1030928261 7:115485309-115485331 TGAGGCCACATGGTGGTAAGTGG + Intergenic
1031400848 7:121325108-121325130 CGCGCGCACATGGTGGGGAGGGG - Intergenic
1033710263 7:143935588-143935610 CACAGCCACATGGCGGTCATAGG - Exonic
1035066009 7:156105547-156105569 CGGGGCCACATGGAGGCGAGGGG + Intergenic
1035281093 7:157779015-157779037 CACGGCCACCTGGCTGTGAGCGG - Intronic
1035587413 8:786542-786564 CGCGGCCACAGAGAGGTGAGTGG + Intergenic
1035755009 8:2024207-2024229 CACCGCCATCTGCTGGTGAGCGG + Intergenic
1038528832 8:28300040-28300062 GACGGCCAAATGGAGGTGACTGG + Intergenic
1039361016 8:36876892-36876914 CAAGGCCAGATGTTGGTGATGGG + Intronic
1040545627 8:48396416-48396438 CACGGCCAGGTGGCGGCGAGGGG + Intergenic
1045880838 8:107038045-107038067 CACTGTCACATGCTGTTGAGAGG + Intergenic
1046492646 8:114972643-114972665 CACGCACATATGGTGGAGAGGGG - Intergenic
1046722403 8:117635593-117635615 CAGGGCCACATCATGGTCAGAGG + Intergenic
1049016582 8:139924362-139924384 CCCGGCCACATGGAGCTGAAGGG + Intronic
1049106787 8:140619014-140619036 CACGGCGGCATGATGGGGAGGGG + Intronic
1050450133 9:5771803-5771825 GACGGCCACATGGGGGAGGGAGG - Intronic
1057189091 9:93076235-93076257 CACAGCCTCTTGGCGGTGAGGGG - Intronic
1057311417 9:93945569-93945591 CAAGGTCACATGGTGGTCTGCGG + Intergenic
1059945943 9:119408391-119408413 CACAGCCTGATGGTGGGGAGAGG + Intergenic
1061306932 9:129737744-129737766 CACTGCCCCCTGGTGGTAAGGGG - Intergenic
1061954307 9:133953639-133953661 CTGGGCCCCATGGTGGTCAGAGG - Intronic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1191860849 X:65665791-65665813 CAAGGCCACATAGTGGTCATAGG + Intronic
1198007260 X:132508107-132508129 CAAGGTCACATGGTGGTAATGGG + Intergenic
1200876146 Y:8156520-8156542 CATTGCCCCATGGTGGTTAGTGG + Intergenic