ID: 978206898

View in Genome Browser
Species Human (GRCh38)
Location 4:106090321-106090343
Sequence CTGAGGCTGTGCAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978206892_978206898 8 Left 978206892 4:106090290-106090312 CCTGAGTGGTCACGATGCAGGGA 0: 1
1: 0
2: 3
3: 15
4: 155
Right 978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG No data
978206887_978206898 29 Left 978206887 4:106090269-106090291 CCAGTTAAGCTGTGGCCGGAGCC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG No data
978206889_978206898 14 Left 978206889 4:106090284-106090306 CCGGAGCCTGAGTGGTCACGATG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG No data
978206886_978206898 30 Left 978206886 4:106090268-106090290 CCCAGTTAAGCTGTGGCCGGAGC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978206898 Original CRISPR CTGAGGCTGTGCAGGGAAGT GGG Intronic
No off target data available for this crispr