ID: 978211486

View in Genome Browser
Species Human (GRCh38)
Location 4:106142772-106142794
Sequence ATTTTCTTCATGAAGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 393}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978211486_978211489 17 Left 978211486 4:106142772-106142794 CCATCACTCTTCATGAAGAAAAT 0: 1
1: 0
2: 4
3: 45
4: 393
Right 978211489 4:106142812-106142834 TGGTGGAAAAACATCACTACAGG No data
978211486_978211488 0 Left 978211486 4:106142772-106142794 CCATCACTCTTCATGAAGAAAAT 0: 1
1: 0
2: 4
3: 45
4: 393
Right 978211488 4:106142795-106142817 ATATTCTATAGACTTTCTGGTGG No data
978211486_978211487 -3 Left 978211486 4:106142772-106142794 CCATCACTCTTCATGAAGAAAAT 0: 1
1: 0
2: 4
3: 45
4: 393
Right 978211487 4:106142792-106142814 AATATATTCTATAGACTTTCTGG 0: 1
1: 0
2: 2
3: 29
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978211486 Original CRISPR ATTTTCTTCATGAAGAGTGA TGG (reversed) Intronic
902134521 1:14293425-14293447 ATTTTCTTAAAGAAGAAGGAGGG - Intergenic
902768204 1:18630749-18630771 CTTTTATTCATGAGGAGGGAAGG - Intergenic
903585519 1:24412735-24412757 ATTTTCTTCATAAATATTGGTGG + Intronic
906350496 1:45054828-45054850 ATTTTCTTCTTGAGCAATGATGG + Intronic
908373498 1:63507398-63507420 ATTTACTTCATGAAGAGAACGGG + Intronic
909286160 1:73821341-73821363 ATTTTCTTCATTCAGACTTAAGG - Intergenic
909718765 1:78741081-78741103 ATTTTGTTCATGGAGAGGCAAGG + Intergenic
909789805 1:79661695-79661717 ATTTTTTTGATGAAAAGGGAGGG - Intergenic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
911736910 1:101346886-101346908 ATTTTTATCATGAAGAATGTTGG + Intergenic
911779937 1:101863694-101863716 ATTTTTTTCATGAAGAATTGTGG + Intronic
912049394 1:105506047-105506069 ATTTTCCTGATGATTAGTGATGG - Intergenic
912669386 1:111610116-111610138 ATTTTTCTAAGGAAGAGTGAGGG - Intronic
917404641 1:174691934-174691956 ATTTTCTTTATGCCGATTGAGGG + Intronic
917667748 1:177241574-177241596 ATTTTCTTCATGAAGAAAGATGG - Intronic
918333977 1:183489108-183489130 ATTTTCTGTATGAAAAGTGAGGG - Intronic
918443102 1:184588187-184588209 ATTTTCTTAAAAAAGAGTAAGGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918573014 1:186021189-186021211 AGATTCTTTATGAAAAGTGAAGG + Intronic
918874336 1:190020150-190020172 ATTTTCATCATGAACAGTTGTGG - Intergenic
919014196 1:192009034-192009056 ATTTTCTTCATAAATAATAATGG - Intergenic
919227722 1:194729285-194729307 ATTTTATTGGTGAAGAATGAGGG - Intergenic
920662296 1:207925530-207925552 ATTCTCTTCATGAAGTGTGTGGG - Intergenic
920853177 1:209642890-209642912 ATTATCCCCATGAAGACTGAGGG - Intronic
920979432 1:210819372-210819394 TTATTCTTCAGGAAGAGAGATGG + Intronic
921899766 1:220437673-220437695 ATTTTCTTCATGAATTGAGTAGG + Intergenic
922382806 1:225049647-225049669 ATTTTCTCCTTGAAGATTTATGG + Intronic
924484636 1:244468967-244468989 CTTTTCATCAAGAAGAGTCACGG - Intronic
1062945125 10:1454914-1454936 ATATTCTTCATGAATTGAGATGG + Intronic
1063225421 10:4011002-4011024 ATTTTCTTTAGGAAGAGTTGTGG - Intergenic
1065363136 10:24908407-24908429 AGTTTCTTCATGAAGACTGTGGG + Intronic
1065639730 10:27769362-27769384 GTGTTCTCCATGAAGTGTGATGG - Intergenic
1067561234 10:47306130-47306152 ATTTTCACCATGAAGAGAGTAGG - Intronic
1068112640 10:52697819-52697841 ATATACTTCAGGAAGAGGGAAGG - Intergenic
1068328118 10:55522277-55522299 ATTTCCTTGATGAATAGAGATGG + Intronic
1068731004 10:60357767-60357789 ATTTTCTCTATGAAGTATGAGGG - Intronic
1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG + Intergenic
1071166920 10:82817591-82817613 CTTATCTCCATGAAGAATGAAGG + Intronic
1071955409 10:90752351-90752373 ATTTTCTTCATATAGACTGTAGG - Intronic
1072703081 10:97658812-97658834 ATTTCCTTAATGATTAGTGATGG + Intronic
1072897417 10:99378728-99378750 ATTTTCTAGATGAAGAGTTCAGG + Intronic
1074901769 10:117822864-117822886 ATTTTCCTCAGTTAGAGTGAGGG - Intergenic
1076031717 10:127164555-127164577 ATTTTCTTCATCATGCATGATGG - Intronic
1076129696 10:128004973-128004995 ATTTCTTTAATGAATAGTGATGG + Intronic
1076326509 10:129627553-129627575 ATATTCATCATGAAGAGTGGAGG - Intronic
1076360965 10:129888739-129888761 ATGTTCTTCATGAATAATTAAGG - Intronic
1076604451 10:131680412-131680434 ACTTTCTTCACTCAGAGTGAAGG + Intergenic
1076671977 10:132126684-132126706 ATTTTTTTCATGAATGGTTATGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078825769 11:14929107-14929129 ATTCTCATCATGAAGAGTCGGGG + Intronic
1078913116 11:15751631-15751653 TTTTTCTACCTGAAGGGTGAGGG - Intergenic
1079176008 11:18141275-18141297 ATTTTCTTCATGAAGTGGAAAGG - Intronic
1079179505 11:18177001-18177023 ATTTTCTTCATGAAGTGGAAAGG - Intronic
1079263529 11:18907647-18907669 ATTTGCTTCATGAAGTGGAAAGG + Intergenic
1079265754 11:18931082-18931104 ATTTTCTTCATGAAGGTGAAAGG + Intergenic
1079267913 11:18953271-18953293 ATTTTCTTCATGAAGTGGAAAGG + Intergenic
1079269350 11:18968983-18969005 ATTTTCTTCATGAAGTGGAAAGG + Intergenic
1079275583 11:19033463-19033485 TTTTGCTTCATGAATAGTGTGGG - Intergenic
1080158136 11:29137429-29137451 ACTTTCTTCCTAAAGAGAGATGG + Intergenic
1082207177 11:49451732-49451754 ATTTTCTTATTCAAGTGTGAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1085497960 11:76989430-76989452 AGTTTATACATGAAGAGTAATGG + Intronic
1085607469 11:77915238-77915260 ATTTTCTTGTTGAACTGTGAAGG + Intronic
1086075823 11:82851114-82851136 ATTGTCTTCATGTAGAGAGCAGG - Intronic
1086399736 11:86450658-86450680 ATTTTCTTTATGAATGATGATGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087252031 11:95913146-95913168 ATTTTTTTCAGGAACAGTGATGG + Intronic
1087505676 11:99018360-99018382 ATTTTCTGCTTGGAGAGTAAGGG - Intergenic
1087805900 11:102555082-102555104 TTTTTCTTCATGAAGAAAGAAGG + Intergenic
1089265843 11:117260957-117260979 ATTTTCTACATAAACAGTCATGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091894975 12:4094914-4094936 ATTTTCTTCATAAAGAATCATGG - Intergenic
1092365306 12:7872462-7872484 TTTTTATTCATGAAGATTTACGG + Intronic
1093235875 12:16607804-16607826 TTTTTCTTCATAAAGAATAAAGG + Intronic
1093546096 12:20350589-20350611 ATTTTTCTCAGGAAGAATGAAGG - Intergenic
1093725856 12:22507512-22507534 ATTTTATTCTTTAAGAGAGAAGG - Intronic
1094094778 12:26691378-26691400 ATTTTCATGCTGAAGAGAGAGGG - Intronic
1095252105 12:39990977-39990999 ATTTTCCTCCTGTAAAGTGAAGG + Intronic
1095342174 12:41103675-41103697 ATTGTCATCATGAAGCATGAAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097775698 12:63641989-63642011 ATTTTCTTTATGACTAATGATGG + Intronic
1099046697 12:77729361-77729383 ATTTCATACTTGAAGAGTGAAGG + Intergenic
1099048450 12:77753511-77753533 ATTGTCTTTAAGAAGAGAGATGG - Intergenic
1099092213 12:78326355-78326377 ATTTTGTGGATGAAGAATGAAGG + Intergenic
1099094832 12:78361216-78361238 TTTTTCTTCATAAAGTGTAAAGG + Intergenic
1099151317 12:79117452-79117474 AGTTTACTCTTGAAGAGTGATGG - Intronic
1099274395 12:80556735-80556757 ACTATTTTCATGAATAGTGAGGG - Intronic
1099938427 12:89156124-89156146 ATTTTCTTTTTAAAGAGTGCTGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101206704 12:102495666-102495688 ATTTTCCTTGTGAAGAGTCAGGG - Intergenic
1101830623 12:108253679-108253701 ATCCTCTTCCTGAAGAGTGGGGG + Intergenic
1104068305 12:125323819-125323841 ATTTTCTTCATTAAGAAACAAGG - Intronic
1106438855 13:29747743-29747765 ATATTCTTACTTAAGAGTGATGG + Intergenic
1106624560 13:31407133-31407155 AGCTTCTCCCTGAAGAGTGAAGG - Intergenic
1106677084 13:31972080-31972102 AATTCCTTTATGAAAAGTGAAGG - Intergenic
1106842596 13:33700374-33700396 ATTTCCTTAATGAATAATGATGG + Intergenic
1107255571 13:38422310-38422332 ATTTCTTTCATGATGAGTCATGG + Intergenic
1108010372 13:46001272-46001294 AATTTCTTCATTCAGAGTAATGG + Intronic
1108671067 13:52689284-52689306 TTTTTCTTCTTGAACACTGAAGG + Intronic
1108800747 13:54092268-54092290 ATATTCTTCCTGCAGTGTGAGGG + Intergenic
1108879610 13:55094017-55094039 AATTTCTTCTTGAATACTGAGGG - Intergenic
1110191642 13:72736353-72736375 ATTACCTTCATGAAGTGGGATGG - Intronic
1110237961 13:73235993-73236015 ATGTTCTCCATTCAGAGTGAAGG - Intergenic
1110462096 13:75756538-75756560 AGTTCCTTCATGAAGACTCAAGG - Intronic
1110584585 13:77173576-77173598 CTTTCCTTCATGAAGAGTCTAGG - Intronic
1111084107 13:83351628-83351650 ATTATCTTCTTGAAGACAGAGGG + Intergenic
1111594512 13:90394775-90394797 ATTTTTTCCATGATGAGTCATGG - Intergenic
1112520756 13:100093034-100093056 ACATTTTTGATGAAGAGTGAGGG + Intronic
1115667376 14:35566517-35566539 ATTTCTTTTATGAAGAGTAAAGG + Intronic
1116191368 14:41672804-41672826 ATTTTCTTCAAGAGAAATGATGG + Intronic
1116416177 14:44680390-44680412 ATTTTATTCATGAAAAGCCATGG + Intergenic
1116982453 14:51186079-51186101 ATTTTTTTAAAGAAGAGAGAAGG - Intergenic
1117971662 14:61256969-61256991 ATTTTCTCCATAAAGAGACATGG - Intronic
1119863926 14:77957319-77957341 ATTTTCTTCAGGAAGAGGTGAGG - Intergenic
1120649699 14:87117501-87117523 ATTTTTTCCATGATGAGTCATGG - Intergenic
1121533756 14:94677055-94677077 ATTTTCCTCCTGAAGGGTCAGGG - Intergenic
1122057030 14:99106560-99106582 ATTTCCTTCATGAATAATGAGGG - Intergenic
1122549768 14:102543628-102543650 GGTTGCTTCATGAAGAGTGATGG - Intergenic
1123501912 15:20894258-20894280 CATTTCTTAATGAAGAGTGATGG + Intergenic
1123559165 15:21467957-21467979 CATTTCTTAATGAAGAGTGATGG + Intergenic
1123595396 15:21905238-21905260 CATTTCTTAATGAAGAGTGATGG + Intergenic
1125233907 15:37489608-37489630 ATATTCTACTTGAAGACTGAGGG + Intergenic
1127184953 15:56469086-56469108 AAATTCATCATGAAGAGTGGAGG + Intergenic
1128601799 15:69001228-69001250 ATTTTCCTCAAGATGAGGGATGG + Intronic
1129643397 15:77406748-77406770 ATTTTTTCTATGAAGAATGATGG - Intronic
1129916702 15:79280476-79280498 TTTTTCTACATTAAGTGTGAGGG + Intergenic
1129979929 15:79859446-79859468 ATTTTGTTCATGAAAAGGTAGGG + Intronic
1130361906 15:83196852-83196874 ATTTTCTCTATGAAGTATGAAGG + Intronic
1131108926 15:89752059-89752081 ATTTTCATCACGAAGGGTGTTGG - Intergenic
1131554306 15:93383576-93383598 TTTTCCTTCATGACGAATGACGG + Intergenic
1131962027 15:97800033-97800055 ACTTTCTTTCTGAAGGGTGAGGG + Intergenic
1202967513 15_KI270727v1_random:195116-195138 CATTTCTTAATGAAGAGTGATGG + Intergenic
1134482638 16:14632567-14632589 ATTTTCTACATAAAATGTGAAGG + Intronic
1135240135 16:20798132-20798154 CTTTTCTTCATGAATAGTGAAGG + Exonic
1136668063 16:31831732-31831754 AGCTTCTTCCTGAACAGTGAAGG + Intergenic
1138026435 16:53525820-53525842 ATTTTCTTCAAGCAGAGAAAAGG - Intergenic
1138797419 16:59985927-59985949 ATTTTCATGATGATTAGTGATGG - Intergenic
1141449976 16:84092706-84092728 AGTTTCCAAATGAAGAGTGAAGG + Intronic
1143734645 17:8902105-8902127 ATTTTCTTTATGAGTAGTGAGGG + Intronic
1145194705 17:20881394-20881416 ATTTTTTTCAGAAAGGGTGAAGG + Intronic
1147502939 17:40983272-40983294 TTTTTCTTCATGAAGTGACAAGG - Intronic
1148182388 17:45615694-45615716 ATTTTCTTAATGAACATTGAGGG + Intergenic
1148266469 17:46230016-46230038 ATTTTCTTAATGAACATTGAGGG - Intergenic
1149295808 17:55261542-55261564 ATTTTCCTGATGAAAAATGATGG - Intergenic
1149355857 17:55838630-55838652 ATTTATTGAATGAAGAGTGACGG + Intronic
1152081473 17:78190184-78190206 ACTTTCTGCATAAAGTGTGAAGG + Intronic
1152582923 17:81176193-81176215 ATTTCCCTCATGATTAGTGATGG - Intergenic
1153411059 18:4793363-4793385 ATATTCTTGATGAACATTGATGG + Intergenic
1153623903 18:7005234-7005256 AGATTATTCATGAAAAGTGATGG - Intronic
1154065503 18:11103360-11103382 TTTTTATTTATTAAGAGTGATGG + Intronic
1155552884 18:26984767-26984789 ATTTTCCTCATGACTAATGAAGG - Intronic
1156129285 18:33950612-33950634 AATTTCTTCTTGAAGAGCTAAGG + Intronic
1156213399 18:34972431-34972453 ATTCTCTCCTTGAGGAGTGAAGG - Intergenic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1156729257 18:40170584-40170606 ATTTTCTTCCTGAAATATGAGGG - Intergenic
1157077010 18:44477364-44477386 ATATTATTCATGAATAATGATGG - Intergenic
1157645656 18:49267134-49267156 ATTATCAGCATGAAGAATGAAGG + Intronic
1158416389 18:57252881-57252903 AGTTTCCTCATGTAGACTGAGGG + Intergenic
1158546407 18:58401532-58401554 ATTTTCTACATCAAGTGTTATGG + Intronic
1158751958 18:60272250-60272272 ATTTTCTTTTTCAAGAGTGTAGG - Intergenic
1159352737 18:67296579-67296601 GTTTTCTTCCTGAAGATTTATGG + Intergenic
1160360603 18:78273242-78273264 GTGTTCTTCAGGAAGACTGAAGG - Intergenic
1161929213 19:7325050-7325072 TTTTTCTTAATGAATAATGATGG - Intergenic
1163134615 19:15300683-15300705 TATTTCTTCATGACTAGTGACGG - Intronic
1164641936 19:29832617-29832639 ATTTTCTTTTTTAAGAGAGAGGG + Intergenic
1164758328 19:30707625-30707647 ATTGTCTTCTTGAAGTGGGAAGG + Intronic
1164978483 19:32593700-32593722 TTTTTCTTCCTGAAGAGTGCTGG - Intergenic
1165026069 19:32962504-32962526 ATTTTCTTCTAGAAGTGTTATGG - Intronic
1165644522 19:37423788-37423810 ATTTCCTTTATGATGAGTGAAGG - Intronic
1166595070 19:44040009-44040031 ATTTTCTTATTCAATAGTGAAGG + Intergenic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1167019976 19:46866248-46866270 ATTCTTTGCATGAAGAGAGAAGG + Intergenic
1167994792 19:53393710-53393732 ATTAGCTTCATGCAGAGGGAGGG - Intronic
926020810 2:9494184-9494206 ATTTTTCTCATGCAGAATGATGG - Intronic
926503995 2:13688112-13688134 ATCTTCTCCATGATGAGTCATGG - Intergenic
927457517 2:23268495-23268517 ATTTTTTTCATGAAGATTAGAGG + Intergenic
927499738 2:23574827-23574849 ATTTCCTTGATGAAGAGAAATGG + Intronic
927635012 2:24807865-24807887 ATTTGCTTCATAACCAGTGATGG + Intronic
928126747 2:28621593-28621615 ATTTTCTGCATGGAGCGTGCTGG + Intronic
928330082 2:30350960-30350982 ATTTTCTTAAAGACGAGTGTGGG - Intergenic
928949943 2:36805590-36805612 ATTTTCTTCATCACCATTGAAGG + Exonic
929003994 2:37378039-37378061 ATGTTTGTCATGAAGACTGAGGG + Intergenic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
931704917 2:64939254-64939276 ATTTTATTCGTGGAGAGGGAGGG + Intergenic
932530312 2:72523476-72523498 ATTCTCTTCATTAAGATTTACGG + Intronic
932591895 2:73072339-73072361 ATTTTGTGCAAGCAGAGTGATGG - Intronic
933074137 2:77901668-77901690 ATATTTTCCATGGAGAGTGATGG - Intergenic
933650830 2:84848943-84848965 ATTTCCTTCAGAAACAGTGAAGG - Intronic
933977744 2:87525465-87525487 ACTTTCTTCATGGAGAGCCATGG - Intergenic
935313665 2:101810092-101810114 ATTTTCTTCATTTTAAGTGAAGG + Intronic
936314404 2:111412478-111412500 ATTGTCATGAGGAAGAGTGAAGG - Intergenic
936316087 2:111425342-111425364 ACTTTCTTCATGGAGAGCCATGG + Intergenic
936760377 2:115771951-115771973 ATTTTCATTATGGAGAGTGATGG + Intronic
937491830 2:122377539-122377561 ATTTACTTCATGAAGATTCAAGG + Intergenic
939251032 2:139681772-139681794 ATTTTCATCATGTAGAGACAGGG + Intergenic
939537309 2:143447833-143447855 ATTTTATGCATGAGGAATGAAGG + Intronic
939639932 2:144627993-144628015 CTTCTCTGCATGAAGAGAGATGG + Intergenic
939739533 2:145888253-145888275 ATTGTCTTCATCAAGAGAGTAGG + Intergenic
940320697 2:152373327-152373349 ATTTTCTCCATGAACAGTTGGGG + Intronic
940901611 2:159131173-159131195 ATATTCTACATGCAGACTGATGG - Intronic
944125242 2:196285213-196285235 TATTTCTTCATAAATAGTGATGG - Intronic
944773939 2:202942804-202942826 ATTTGCTTCACGAGTAGTGATGG - Exonic
944853658 2:203745341-203745363 ATTTTCTCCAGAAAAAGTGATGG - Intergenic
945291521 2:208132226-208132248 ATTTTCTTTATGTAGAGACAGGG + Intergenic
945983241 2:216333043-216333065 GTTTTCTTCTAGAAGAGTTATGG - Intronic
946296938 2:218792104-218792126 ATGTTTTTCATGATGAGTTATGG + Intronic
946882746 2:224192862-224192884 ATTGGCTTCATTAAGAGTGAAGG + Intergenic
947060224 2:226156096-226156118 ATTTTGTTCATGCCAAGTGAAGG + Intergenic
947212391 2:227719902-227719924 ATTTTCTTCAAGAGGTGTGAAGG - Intergenic
1169277270 20:4242435-4242457 ATATGCATCATGAAGTGTGAGGG - Intronic
1169959393 20:11142231-11142253 ATTTTTTTCAAGAAGAGGGTTGG - Intergenic
1170009326 20:11704384-11704406 AACTTCTTCATCAGGAGTGAAGG + Intergenic
1171062168 20:21976165-21976187 ATATTATTGATGAACAGTGATGG + Intergenic
1172927226 20:38549232-38549254 ATTTTTTTTATAAAGAGTCAGGG + Intronic
1174769582 20:53286018-53286040 ATTTTTATTATGAAAAGTGAAGG + Intronic
1175471768 20:59235140-59235162 ATTTTCCTCATGATGAGTCTGGG + Intronic
1175673673 20:60928769-60928791 ATTGGCTCCATGAAGAGTCATGG - Intergenic
1177383408 21:20375506-20375528 TGTTTCTTAATTAAGAGTGAAGG - Intergenic
1177502540 21:21976610-21976632 ATGTTCTTCATCAAGTGTGTAGG - Intergenic
1179303935 21:40137903-40137925 ATTTTTTCCATGAAGAAAGATGG + Intronic
1182315178 22:29441270-29441292 CTTTTCTTCATTTAGAGTGGAGG - Intronic
1182515697 22:30857675-30857697 ATTTTGTAGATGAAGACTGAAGG + Intronic
1182701003 22:32238293-32238315 AGTTTCTTCGGGAATAGTGAGGG - Intronic
1182716486 22:32359980-32360002 CTTTTCTTCATTTAGAGTGGAGG - Exonic
1182958775 22:34452724-34452746 ATTTTATAGATGAAGAGAGATGG + Intergenic
1184077661 22:42193188-42193210 ATTTTCTTCATGGAGACTCTTGG - Intronic
1184329426 22:43817422-43817444 AGTTTCTTCTTGAATACTGAGGG - Intergenic
1184532503 22:45065224-45065246 ATTTTCTTCAGCAAGTGTGCAGG - Intergenic
1185132970 22:49050890-49050912 ATTTTCTTGATTAACAGTGTGGG + Intergenic
949200964 3:1378821-1378843 ATTGTCTTCATGCACTGTGATGG + Intronic
949275156 3:2270692-2270714 ATTTGCTTAAGGAAGACTGAAGG + Intronic
949385148 3:3493506-3493528 ATTTTCCTGATGATTAGTGATGG - Intergenic
950095257 3:10325291-10325313 ATTTTGTAAAAGAAGAGTGAAGG + Exonic
950166012 3:10799520-10799542 GTTTTCTTCAGGAAGAGGGTGGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951761749 3:26155429-26155451 ATTTTCTAAATAAAGAGGGATGG - Intergenic
951800788 3:26593812-26593834 ATTTCCTTGATGATTAGTGATGG + Intergenic
952195033 3:31066260-31066282 ATTTTCATTAAGGAGAGTGAAGG - Intergenic
952910042 3:38176198-38176220 ATTTACATCAAGAAGAATGATGG + Intronic
953597992 3:44336351-44336373 ATTTTCCTCATGGATATTGATGG - Intergenic
955074845 3:55603724-55603746 ATTTTCTTCATAATGAGACAGGG - Intronic
956231815 3:67025821-67025843 ATTTTCTTCATTAAATTTGAAGG - Intergenic
956358610 3:68420898-68420920 AGTTTCTTCTTTAAGAGAGAGGG - Intronic
957280809 3:78148955-78148977 AGTTTCAACATGAAGAGAGAGGG + Intergenic
957291173 3:78280249-78280271 AATTTCTTCAGGTAGACTGAGGG - Intergenic
957441578 3:80254895-80254917 ATTTTTTTAGTAAAGAGTGAGGG - Intergenic
957802843 3:85107360-85107382 ATTTTCTTAATGACTGGTGATGG - Intronic
957893005 3:86383934-86383956 CCTTTCTTCATGATGAGTAAAGG - Intergenic
958725657 3:97902731-97902753 TTTTTTTTCCTGAAGACTGAAGG + Intronic
958971234 3:100612476-100612498 ACTTTCATCATCAAGAGTGAAGG - Intronic
959032109 3:101311023-101311045 ATTTCCAGCATGAAGAGTGAGGG + Intronic
960105448 3:113790751-113790773 AGTTTCTTCAAGAAGACTTATGG + Intronic
960552657 3:118993894-118993916 GTTTTCTTTCTGGAGAGTGATGG + Intronic
963760154 3:149279953-149279975 TTTTTCTTGTTGAAGGGTGAAGG + Intergenic
963970467 3:151424011-151424033 AATTTCTTGAGGAAGAGTCAAGG - Intronic
966244991 3:177797673-177797695 AGTTTTTTCAGGAAAAGTGAGGG - Intergenic
966365854 3:179186591-179186613 ATTTTCTTCCTGAAGTATGTGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
968832414 4:2939860-2939882 ACTGTCTTCTTGAAGAGGGAGGG + Intronic
969060581 4:4431146-4431168 ATTTCCTTTATGAAGAGTGGTGG + Intronic
969283074 4:6184491-6184513 ATTTTCTTGAGGAAGAGGGAAGG - Intronic
969983013 4:11178571-11178593 ATTCCCTTCATGAGGTGTGAGGG + Intergenic
970265163 4:14274791-14274813 ATTTTGTTCAGGAAGACAGAAGG + Intergenic
971877481 4:32324682-32324704 AATTCCTTCATGAAGCGAGAAGG - Intergenic
971902107 4:32673669-32673691 TTTATCTTCATGAAGAGTAGTGG - Intergenic
972315024 4:37918323-37918345 ATTTTCTTCATGAAGCACAAAGG - Intronic
972825053 4:42748592-42748614 ATTTTCTAAATGAGGAGAGAAGG - Intergenic
973020203 4:45195350-45195372 ATTTTCTTTATAAATAGTGATGG - Intergenic
973813957 4:54601084-54601106 ATCTTTTTCATGACGAGTCATGG + Intergenic
973988089 4:56375571-56375593 ATTTGCTTAATGAGGGGTGAAGG - Intronic
974506163 4:62775065-62775087 ATTTGACGCATGAAGAGTGAAGG + Intergenic
975000063 4:69213389-69213411 ATTATCTTGTTGAAGTGTGAAGG - Intronic
975005706 4:69281812-69281834 ATTATCTTGTTGAAGTGTGAAGG + Intronic
975014117 4:69390760-69390782 ATTATCTTGTTGAAGTGTGAAGG + Intronic
975015371 4:69410146-69410168 ATTATCTTGTTGAAGTGTGAAGG + Intronic
975612003 4:76213082-76213104 TGTTTCTTCATGAAGTGGGAAGG + Intronic
976106512 4:81624848-81624870 ACATTCTTCAGGAAGATTGAAGG - Intronic
977104982 4:92870996-92871018 ATTTTTTTCATTAAGATGGATGG + Intronic
977213875 4:94255717-94255739 ATTTTCCTCATGTAAAATGAGGG - Intronic
977267823 4:94877176-94877198 ATTTTCTTCATGGAGAGAGATGG + Intronic
977351273 4:95890912-95890934 AGTTTCTTCAAGAAGACTCATGG + Intergenic
977791196 4:101105558-101105580 TTTTTTTTCTTGAAGAGTGCAGG - Intronic
978211486 4:106142772-106142794 ATTTTCTTCATGAAGAGTGATGG - Intronic
978423753 4:108561115-108561137 ATATTATTCATGAAGACTAATGG - Intergenic
978460648 4:108947864-108947886 ATTTTAATTATGAAGAGTCAAGG + Intronic
979549585 4:121975836-121975858 ATTTGCTTAGTGAGGAGTGAGGG - Intergenic
981002517 4:139841372-139841394 ATCTTCTTCATGTAGGGTCAAGG + Intronic
982499663 4:156137329-156137351 ATTTTCTTCAGCAGGAGCGAAGG + Intergenic
983102298 4:163639870-163639892 ATTTTGTTGGTGAAGAGTTAGGG + Intronic
983739411 4:171109772-171109794 ATTTTCTTTATCAAGACTGCAGG + Intergenic
986457567 5:7934444-7934466 ACTTTCTTAATGAACACTGAAGG + Intergenic
986493154 5:8314461-8314483 GTTTTGTTTATGAAGAGTTACGG + Intergenic
986621507 5:9680596-9680618 ATTTTTTTCATGATGAGAGTAGG - Intronic
987363837 5:17130648-17130670 AGATTTATCATGAAGAGTGAAGG + Intronic
987451937 5:18096054-18096076 ATTGTCTTGATCATGAGTGATGG - Intergenic
987734506 5:21823478-21823500 ATTATCATCATCAAGAGTTAGGG - Intronic
987744454 5:21951843-21951865 ATTTCCTTAAGCAAGAGTGAGGG + Intronic
988558107 5:32255723-32255745 ATTCTCTTCAGGAAGAGGGGTGG + Exonic
988692774 5:33589064-33589086 GTTTTCTTCCTGAAAAGAGAGGG - Intronic
988785796 5:34564543-34564565 ATTTTCTCTAAGCAGAGTGATGG - Intergenic
988947682 5:36222875-36222897 ATTTCATTCATCAAGAATGATGG + Intronic
989317503 5:40099632-40099654 ACTTTATTCTTGAAGAGGGAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989781651 5:45272776-45272798 ATTTTCTTCCTGATGAGTAAAGG - Intronic
990166722 5:53002829-53002851 ATTTACTTCTTGAAGTTTGATGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990349831 5:54904702-54904724 AGTTTCATCATGAAGGGTGAAGG - Intergenic
990850425 5:60196674-60196696 ATTTTCCTCATGATGACTCAGGG - Intronic
991196619 5:63941715-63941737 ACCTTGTTCATGAAAAGTGAAGG + Intergenic
991595106 5:68296129-68296151 AGTTTCTAAATGAAGAGTGCAGG - Intronic
991764664 5:69961967-69961989 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991782660 5:70156186-70156208 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
991843896 5:70837038-70837060 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991875103 5:71156500-71156522 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
992955763 5:81906599-81906621 GATTTCTTCATGCACAGTGAAGG - Intergenic
993196725 5:84757905-84757927 ATGTTCTTCATGAAGACTCCAGG - Intergenic
993367913 5:87055644-87055666 ATTTTCAACATGGAGAGTAAAGG + Intergenic
993897030 5:93548107-93548129 ATTTCCTTCAGGAAAACTGAAGG - Intergenic
994070963 5:95601860-95601882 ATTTTCATCCTGATGAGTAATGG + Intronic
994336027 5:98567480-98567502 ATTTTCTTCATTATAATTGATGG + Intergenic
994558012 5:101329968-101329990 AGATTCTTCATGAGGAATGAGGG - Intergenic
996330821 5:122326873-122326895 ATTTTCTTTATAAAGACAGAAGG - Intronic
996399900 5:123050525-123050547 ATATTCCTCATGAACAGAGATGG - Intergenic
999560809 5:152800176-152800198 ATTTTCTTCATAAATAGTTTTGG - Intergenic
999815040 5:155167602-155167624 ATTCTATTCATTACGAGTGAAGG - Intergenic
999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG + Intronic
1001308316 5:170592210-170592232 ATTTTCCTGATGATTAGTGATGG + Intronic
1001872397 5:175168263-175168285 ATTTTCTTATTGAAGAGTATGGG - Intergenic
1002963938 6:1943494-1943516 ATTTTCTGCAGGGAGAGGGAGGG + Intronic
1003507988 6:6755559-6755581 ATTTTCTTAATGATTAGTGATGG + Intergenic
1003988911 6:11466251-11466273 AGTTTCTTCATAGAGATTGAAGG + Intergenic
1004235236 6:13869505-13869527 ATTTTCTTACAGAAGAGAGAAGG - Intergenic
1004713728 6:18196551-18196573 ATTTCCTTGATGATTAGTGATGG + Intronic
1005162842 6:22884348-22884370 ATTTACTTATGGAAGAGTGAAGG - Intergenic
1005288534 6:24355750-24355772 ATTCTTTTCATGGAAAGTGAGGG - Intronic
1007405599 6:41634483-41634505 CTTTTCTTCAGGAAGGGGGAGGG + Intergenic
1008044125 6:46834284-46834306 ACTTTCTTAATGAAAAGAGAGGG - Intronic
1008584602 6:52937294-52937316 ATTTTCTTTATCAGGAGTGCGGG - Intergenic
1008700224 6:54090242-54090264 ATTTTCTGCTGGAAGAGTCATGG - Intronic
1010612112 6:77965308-77965330 AATTTCTTCATTTAAAGTGAAGG + Intergenic
1011369654 6:86621771-86621793 ATTTTCCTGATGATCAGTGATGG + Intergenic
1012938357 6:105391556-105391578 ATTTTCTTCAAGATCAGTGGTGG - Intronic
1014688520 6:124532935-124532957 ATCTTTTTCCTGAAGAGTAAGGG - Intronic
1015203910 6:130613705-130613727 ATATCTTCCATGAAGAGTGACGG - Intergenic
1016299617 6:142615806-142615828 TTTCTCTTCATGAAGACTCAGGG - Intergenic
1016366063 6:143320124-143320146 ATTTCCCTCATGATTAGTGAAGG - Intronic
1016503972 6:144756114-144756136 ATTTACTTCATCAACATTGATGG - Intronic
1016930715 6:149405170-149405192 ATTTTCCTGATGATTAGTGAGGG - Intronic
1017280730 6:152621668-152621690 ACTTTCTCCATGAAGCGCGATGG + Intronic
1017376813 6:153780124-153780146 ATTTTAATCATGCAGAGTAAAGG + Intergenic
1017886142 6:158600866-158600888 ATTTTCTTTCTTAAGAGTTACGG + Intronic
1017920313 6:158866629-158866651 ATTATTTTCATTAAGAGTTATGG + Intergenic
1018282903 6:162206932-162206954 CTTTTCTTCATGTTGAGTGAAGG + Intronic
1020027199 7:4907520-4907542 ATGGTCTTCTTCAAGAGTGACGG - Exonic
1020511401 7:9061489-9061511 ATTTTTTTCCTGAAGAGTGAAGG - Intergenic
1021747978 7:23762786-23762808 TTTTTCTTCCTCCAGAGTGAAGG + Exonic
1022618271 7:31954724-31954746 CTATTCTGCATGAAGAGTAATGG - Intronic
1022722371 7:32952763-32952785 ATTTTCTTGATTACTAGTGAGGG + Intergenic
1022886124 7:34645791-34645813 ATTTTCTTCCTGAAAAGAGCAGG - Intergenic
1022934601 7:35159588-35159610 ATTTTCTTTATGACTAATGATGG + Intergenic
1023364353 7:39448894-39448916 ATTTGCTTAATAAAGTGTGATGG - Intronic
1023675908 7:42630008-42630030 ATTTTCTTTATTAAGATGGAAGG - Intergenic
1023924357 7:44654878-44654900 AATTACTTCTTGAAGAGTGCAGG - Intronic
1025748352 7:64267514-64267536 ATTTTCTTAATGTAGAATAAGGG - Intergenic
1025845483 7:65192691-65192713 ATTTTCTTGTTGAACTGTGAAGG - Intergenic
1025895760 7:65698723-65698745 ATTTTCTTGTTGAACTGTGAAGG - Intergenic
1027005534 7:74689662-74689684 TTTTTCTTCTTGAATAGTTATGG + Intronic
1028712308 7:93923112-93923134 ATTTTCTTGCTGAAGAGGAAAGG - Intronic
1028944446 7:96561140-96561162 ATTTTCTTAAAAAAGAGTAATGG - Intronic
1028957463 7:96709812-96709834 GTTTCCTTGAGGAAGAGTGAGGG - Exonic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029830541 7:103252368-103252390 ATTTTCTTGATGACTAATGATGG + Intergenic
1029906722 7:104100373-104100395 TTCTTCTTCAGGAAGAGTGCAGG - Intergenic
1030921204 7:115390833-115390855 ATTCTCTACATGAAGTGTGCAGG + Intergenic
1031282918 7:119827496-119827518 ATTTTCTTAATGATTAGTGATGG + Intergenic
1031897556 7:127368988-127369010 GTTTTCTTCTTAAAGAGTAAAGG + Intronic
1032868607 7:135955640-135955662 ATATTCCTCATGACAAGTGATGG + Intronic
1032964334 7:137078632-137078654 GTTGTCTACATGTAGAGTGAAGG - Intergenic
1034186461 7:149181471-149181493 ATTTTCTTGATGAAGTGATAAGG + Intronic
1034342106 7:150364058-150364080 ATTTTCTTTCTGCAGAGTGAAGG + Intergenic
1035461500 7:159041793-159041815 GCTTTCTTCATGAAGAGCTAAGG + Intronic
1036058966 8:5293453-5293475 ATTTTCTTCTTCAAAAGAGATGG + Intergenic
1036591155 8:10169506-10169528 GTTTTCTTCACGAAGTTTGATGG - Intronic
1036981034 8:13470522-13470544 ATTTCCTTGATGATTAGTGATGG - Intronic
1037385535 8:18336415-18336437 AGCTTCTTCCTGAAGAGTTAGGG + Intergenic
1038907963 8:31928235-31928257 ATTTCCCTCATGATTAGTGATGG - Intronic
1039282347 8:35999446-35999468 GTTTTCCTAATGATGAGTGATGG + Intergenic
1039449749 8:37662860-37662882 ATTTTTTTCTTAAAGAGGGAAGG - Intergenic
1040955602 8:52976804-52976826 AGTATCTTCATGAAGACTAAGGG + Intergenic
1041011333 8:53546979-53547001 ATTTTATGCATGAAGGCTGAGGG - Intergenic
1041845776 8:62327052-62327074 ATTTTCCTAATGATTAGTGATGG + Intronic
1042546957 8:69959582-69959604 ATTTTTTTCATGAAGACACAGGG + Intergenic
1043659432 8:82717712-82717734 ATTTTCCTGATGATTAGTGACGG - Intergenic
1043859419 8:85298612-85298634 ATTTTGTTCGTGAAAAGTTATGG + Intergenic
1044271769 8:90253127-90253149 ATTTTCCTCATTATTAGTGAGGG - Intergenic
1047087143 8:121530490-121530512 ATTTACTTCATGTAGACTGTGGG - Intergenic
1048482034 8:134806387-134806409 TTTTTCTTCAAAAACAGTGAAGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050764512 9:9115385-9115407 ATTTTCCTGATGATTAGTGATGG - Intronic
1050959521 9:11709544-11709566 ATTTTATACAGGAAGACTGATGG - Intergenic
1052621112 9:30911370-30911392 ATATTATTCATGAAAACTGAAGG - Intergenic
1053012503 9:34642397-34642419 CTTTTCTTTCTCAAGAGTGATGG + Intronic
1053093032 9:35297393-35297415 ATTTTTTTTTTGAAGAGTGCAGG + Intronic
1053653473 9:40192691-40192713 ATTTTTTTAATGAAAAGAGAGGG + Intergenic
1053838916 9:42172080-42172102 ATTTTCCTGATGATTAGTGACGG + Intergenic
1053879396 9:42576692-42576714 ATTTTCCTGATGATTAGTGATGG - Intergenic
1053893261 9:42717667-42717689 ATTTTCCTGATGATTAGTGATGG + Intergenic
1054117374 9:61178461-61178483 ATTTTCCTGATGATTAGTGATGG + Intergenic
1054232294 9:62525005-62525027 ATTTTCCTGATGATTAGTGATGG + Intergenic
1054590381 9:67004105-67004127 ATTTTCCTGATGATTAGTGATGG - Intergenic
1054962582 9:70985271-70985293 ATTTTCTTCTTAAAGAGAGATGG + Intronic
1055538511 9:77275833-77275855 ACTTCCTTAATCAAGAGTGAAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057223141 9:93268484-93268506 ATTTTCTCCAGGAAGGGTGTGGG - Intronic
1057922637 9:99110067-99110089 ATTTTCTTCATGATGAAGAAGGG - Intronic
1058218512 9:102265180-102265202 ATTATCTTCATGAAAAGTAGTGG + Intergenic
1058358113 9:104107072-104107094 ATTTTTTTCATGAAGCCTGCTGG + Intronic
1058669889 9:107351906-107351928 TTTTTCTTCCTGATTAGTGAAGG - Intergenic
1058953198 9:109922661-109922683 AATGTCTTCAGGAAGAATGAAGG - Intronic
1059592985 9:115683374-115683396 TTTTTCTTCATGTATATTGAAGG + Intergenic
1062652392 9:137584703-137584725 CTTTTCTACATGAAAAGGGAAGG - Intronic
1186107812 X:6226385-6226407 ATGTTCTGCATGGAGAGCGAGGG - Intronic
1187883612 X:23867966-23867988 ACTTTCTTCATTAGGAATGATGG + Intronic
1188183860 X:27089482-27089504 ATTTTCCTAATGAAGGGGGACGG - Intergenic
1188802985 X:34554647-34554669 ATCTTTTTCATGATGAGTCATGG - Intergenic
1190976552 X:55408613-55408635 ATCTTCTCCATGAAGAGACAGGG + Intergenic
1190993340 X:55577211-55577233 TTTTTCTTAATGAATAATGATGG - Intergenic
1191200347 X:57774079-57774101 ATTTTCCTCTTGAAAACTGAAGG - Intergenic
1192052667 X:67740979-67741001 ATCTAGTTAATGAAGAGTGATGG - Intergenic
1193475039 X:81953292-81953314 AGTTTCCTCTTAAAGAGTGAAGG + Intergenic
1193519295 X:82509669-82509691 ATTTTCTTTATTAAGAGTTTAGG + Intergenic
1193617828 X:83711904-83711926 CTTTTCTTCATGATTGGTGAAGG - Intergenic
1194440510 X:93927724-93927746 ATTTCCTACATGAAGAGTCATGG - Intergenic
1195037830 X:100986190-100986212 ATAGTCTTCAGGAAGAGTCAAGG - Intronic
1195412116 X:104578680-104578702 ATTTTCAGCAGGAAGAGAGAGGG + Intronic
1195558798 X:106259033-106259055 ATCTTTTTCATGATGAGTCATGG + Intergenic
1196224331 X:113147674-113147696 AATTGCTTCATGTTGAGTGAAGG + Intergenic
1196844606 X:119888280-119888302 ATTTTCTTCCCGAAGAGGGAGGG + Intergenic
1197530495 X:127618030-127618052 ATTTTCCTTATGATGAGTGATGG - Intergenic
1198949721 X:142057074-142057096 ATCTTCTCCATGATGAGTCATGG + Intergenic
1199312268 X:146334910-146334932 TTTTTCTTCTTGAAAAATGATGG + Intergenic
1200588393 Y:5039291-5039313 AATTTCATCATGAAGAGCAATGG + Intronic