ID: 978222463

View in Genome Browser
Species Human (GRCh38)
Location 4:106293262-106293284
Sequence AAACCCTGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 20, 1: 32, 2: 26, 3: 28, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978222463 Original CRISPR AAACCCTGCTTCACAAAGAT AGG (reversed) Intronic