ID: 978223152 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:106302247-106302269 |
Sequence | CAGAGTAAACAGCAATATAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
978223145_978223152 | 29 | Left | 978223145 | 4:106302195-106302217 | CCTAGCAGAGAGGGCTGCTGAAA | 0: 1 1: 0 2: 3 3: 39 4: 257 |
||
Right | 978223152 | 4:106302247-106302269 | CAGAGTAAACAGCAATATAGTGG | No data | ||||
978223144_978223152 | 30 | Left | 978223144 | 4:106302194-106302216 | CCCTAGCAGAGAGGGCTGCTGAA | 0: 1 1: 0 2: 3 3: 13 4: 187 |
||
Right | 978223152 | 4:106302247-106302269 | CAGAGTAAACAGCAATATAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
978223152 | Original CRISPR | CAGAGTAAACAGCAATATAG TGG | Intronic | ||
No off target data available for this crispr |