ID: 978223152

View in Genome Browser
Species Human (GRCh38)
Location 4:106302247-106302269
Sequence CAGAGTAAACAGCAATATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978223145_978223152 29 Left 978223145 4:106302195-106302217 CCTAGCAGAGAGGGCTGCTGAAA 0: 1
1: 0
2: 3
3: 39
4: 257
Right 978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG No data
978223144_978223152 30 Left 978223144 4:106302194-106302216 CCCTAGCAGAGAGGGCTGCTGAA 0: 1
1: 0
2: 3
3: 13
4: 187
Right 978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978223152 Original CRISPR CAGAGTAAACAGCAATATAG TGG Intronic
No off target data available for this crispr