ID: 978227312

View in Genome Browser
Species Human (GRCh38)
Location 4:106352895-106352917
Sequence TGCCTAGGATTGCTGAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978227306_978227312 24 Left 978227306 4:106352848-106352870 CCCTCAGAAATGAAGACCAAAAG No data
Right 978227312 4:106352895-106352917 TGCCTAGGATTGCTGAAGAATGG No data
978227310_978227312 8 Left 978227310 4:106352864-106352886 CCAAAAGACTCAGGGAAAGCTGT No data
Right 978227312 4:106352895-106352917 TGCCTAGGATTGCTGAAGAATGG No data
978227307_978227312 23 Left 978227307 4:106352849-106352871 CCTCAGAAATGAAGACCAAAAGA No data
Right 978227312 4:106352895-106352917 TGCCTAGGATTGCTGAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978227312 Original CRISPR TGCCTAGGATTGCTGAAGAA TGG Intergenic
No off target data available for this crispr