ID: 978228154

View in Genome Browser
Species Human (GRCh38)
Location 4:106363964-106363986
Sequence GATATAATATAGTCACCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978228154_978228155 -1 Left 978228154 4:106363964-106363986 CCTTGAGGTGACTATATTATATC No data
Right 978228155 4:106363986-106364008 CTTCTCTGATTCATTATTTGTGG No data
978228154_978228156 0 Left 978228154 4:106363964-106363986 CCTTGAGGTGACTATATTATATC No data
Right 978228156 4:106363987-106364009 TTCTCTGATTCATTATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978228154 Original CRISPR GATATAATATAGTCACCTCA AGG (reversed) Intergenic
No off target data available for this crispr