ID: 978231911

View in Genome Browser
Species Human (GRCh38)
Location 4:106410038-106410060
Sequence GAGCCACCACACCAATTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978231909_978231911 2 Left 978231909 4:106410013-106410035 CCGTGTATCTATCACTCGCTGCG No data
Right 978231911 4:106410038-106410060 GAGCCACCACACCAATTCTTTGG No data
978231907_978231911 27 Left 978231907 4:106409988-106410010 CCTACAGCTTTTTCTCTCTATTG No data
Right 978231911 4:106410038-106410060 GAGCCACCACACCAATTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978231911 Original CRISPR GAGCCACCACACCAATTCTT TGG Intergenic