ID: 978232691

View in Genome Browser
Species Human (GRCh38)
Location 4:106419632-106419654
Sequence TCTAGGGCCCCTTCTTATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978232691_978232696 6 Left 978232691 4:106419632-106419654 CCCTTATAAGAAGGGGCCCTAGA No data
Right 978232696 4:106419661-106419683 CTTTGCACCTTCCACCATGAGGG No data
978232691_978232695 5 Left 978232691 4:106419632-106419654 CCCTTATAAGAAGGGGCCCTAGA No data
Right 978232695 4:106419660-106419682 ACTTTGCACCTTCCACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978232691 Original CRISPR TCTAGGGCCCCTTCTTATAA GGG (reversed) Intergenic
No off target data available for this crispr