ID: 978236183

View in Genome Browser
Species Human (GRCh38)
Location 4:106463737-106463759
Sequence CTGAATTCACTTGAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978236181_978236183 -2 Left 978236181 4:106463716-106463738 CCTTTTTTTCTATAGTTATATCT No data
Right 978236183 4:106463737-106463759 CTGAATTCACTTGAGGAGCAAGG No data
978236180_978236183 3 Left 978236180 4:106463711-106463733 CCTAACCTTTTTTTCTATAGTTA No data
Right 978236183 4:106463737-106463759 CTGAATTCACTTGAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978236183 Original CRISPR CTGAATTCACTTGAGGAGCA AGG Intergenic
No off target data available for this crispr