ID: 978245601

View in Genome Browser
Species Human (GRCh38)
Location 4:106568838-106568860
Sequence CAAGCTGCTCTTAGTGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978245601_978245608 18 Left 978245601 4:106568838-106568860 CCCAAATCACTAAGAGCAGCTTG No data
Right 978245608 4:106568879-106568901 TGCTGGCTGCAATCAGGATAGGG No data
978245601_978245609 22 Left 978245601 4:106568838-106568860 CCCAAATCACTAAGAGCAGCTTG No data
Right 978245609 4:106568883-106568905 GGCTGCAATCAGGATAGGGTTGG No data
978245601_978245606 12 Left 978245601 4:106568838-106568860 CCCAAATCACTAAGAGCAGCTTG No data
Right 978245606 4:106568873-106568895 TATTTCTGCTGGCTGCAATCAGG No data
978245601_978245607 17 Left 978245601 4:106568838-106568860 CCCAAATCACTAAGAGCAGCTTG No data
Right 978245607 4:106568878-106568900 CTGCTGGCTGCAATCAGGATAGG No data
978245601_978245604 1 Left 978245601 4:106568838-106568860 CCCAAATCACTAAGAGCAGCTTG No data
Right 978245604 4:106568862-106568884 AGACCTGGAATTATTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978245601 Original CRISPR CAAGCTGCTCTTAGTGATTT GGG (reversed) Intergenic
No off target data available for this crispr