ID: 978245606

View in Genome Browser
Species Human (GRCh38)
Location 4:106568873-106568895
Sequence TATTTCTGCTGGCTGCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978245601_978245606 12 Left 978245601 4:106568838-106568860 CCCAAATCACTAAGAGCAGCTTG No data
Right 978245606 4:106568873-106568895 TATTTCTGCTGGCTGCAATCAGG No data
978245602_978245606 11 Left 978245602 4:106568839-106568861 CCAAATCACTAAGAGCAGCTTGC No data
Right 978245606 4:106568873-106568895 TATTTCTGCTGGCTGCAATCAGG No data
978245600_978245606 16 Left 978245600 4:106568834-106568856 CCTGCCCAAATCACTAAGAGCAG No data
Right 978245606 4:106568873-106568895 TATTTCTGCTGGCTGCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978245606 Original CRISPR TATTTCTGCTGGCTGCAATC AGG Intergenic
No off target data available for this crispr