ID: 978245608

View in Genome Browser
Species Human (GRCh38)
Location 4:106568879-106568901
Sequence TGCTGGCTGCAATCAGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978245601_978245608 18 Left 978245601 4:106568838-106568860 CCCAAATCACTAAGAGCAGCTTG No data
Right 978245608 4:106568879-106568901 TGCTGGCTGCAATCAGGATAGGG No data
978245605_978245608 -9 Left 978245605 4:106568865-106568887 CCTGGAATTATTTCTGCTGGCTG No data
Right 978245608 4:106568879-106568901 TGCTGGCTGCAATCAGGATAGGG No data
978245600_978245608 22 Left 978245600 4:106568834-106568856 CCTGCCCAAATCACTAAGAGCAG No data
Right 978245608 4:106568879-106568901 TGCTGGCTGCAATCAGGATAGGG No data
978245602_978245608 17 Left 978245602 4:106568839-106568861 CCAAATCACTAAGAGCAGCTTGC No data
Right 978245608 4:106568879-106568901 TGCTGGCTGCAATCAGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978245608 Original CRISPR TGCTGGCTGCAATCAGGATA GGG Intergenic
No off target data available for this crispr