ID: 978246746

View in Genome Browser
Species Human (GRCh38)
Location 4:106581360-106581382
Sequence ATCTTTGATCTAATGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978246744_978246746 4 Left 978246744 4:106581333-106581355 CCTCTTTCGAGCAAGGTGGGCAA No data
Right 978246746 4:106581360-106581382 ATCTTTGATCTAATGCTGATGGG No data
978246743_978246746 5 Left 978246743 4:106581332-106581354 CCCTCTTTCGAGCAAGGTGGGCA No data
Right 978246746 4:106581360-106581382 ATCTTTGATCTAATGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978246746 Original CRISPR ATCTTTGATCTAATGCTGAT GGG Intergenic
No off target data available for this crispr