ID: 978252013

View in Genome Browser
Species Human (GRCh38)
Location 4:106642347-106642369
Sequence ATGTGTTGCTGAACTCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978252009_978252013 11 Left 978252009 4:106642313-106642335 CCATGTAAGACAGAAAAGATTAG No data
Right 978252013 4:106642347-106642369 ATGTGTTGCTGAACTCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978252013 Original CRISPR ATGTGTTGCTGAACTCTCGG GGG Intergenic
No off target data available for this crispr