ID: 978252107

View in Genome Browser
Species Human (GRCh38)
Location 4:106643582-106643604
Sequence CTTTGGATAAATACCCAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978252104_978252107 10 Left 978252104 4:106643549-106643571 CCAAGTTTCTCTTCAACGTAGTG No data
Right 978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978252107 Original CRISPR CTTTGGATAAATACCCAGTA TGG Intergenic
No off target data available for this crispr