ID: 978255721

View in Genome Browser
Species Human (GRCh38)
Location 4:106690662-106690684
Sequence TTGACGAGGTTGTAGTTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978255718_978255721 -4 Left 978255718 4:106690643-106690665 CCAGAAAATATGGGCCTCTTTGA No data
Right 978255721 4:106690662-106690684 TTGACGAGGTTGTAGTTGCTAGG No data
978255715_978255721 6 Left 978255715 4:106690633-106690655 CCTTATTTCACCAGAAAATATGG No data
Right 978255721 4:106690662-106690684 TTGACGAGGTTGTAGTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978255721 Original CRISPR TTGACGAGGTTGTAGTTGCT AGG Intergenic
No off target data available for this crispr