ID: 978272689 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:106909562-106909584 |
| Sequence | AAGAACATGGGGAAGTGGTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 978272682_978272689 | 14 | Left | 978272682 | 4:106909525-106909547 | CCAGCAAGGTGTGATGTACACTG | No data | ||
| Right | 978272689 | 4:106909562-106909584 | AAGAACATGGGGAAGTGGTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 978272689 | Original CRISPR | AAGAACATGGGGAAGTGGTT GGG | Intergenic | ||
| No off target data available for this crispr | |||||