ID: 978272689

View in Genome Browser
Species Human (GRCh38)
Location 4:106909562-106909584
Sequence AAGAACATGGGGAAGTGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978272682_978272689 14 Left 978272682 4:106909525-106909547 CCAGCAAGGTGTGATGTACACTG No data
Right 978272689 4:106909562-106909584 AAGAACATGGGGAAGTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978272689 Original CRISPR AAGAACATGGGGAAGTGGTT GGG Intergenic
No off target data available for this crispr