ID: 978273973

View in Genome Browser
Species Human (GRCh38)
Location 4:106926445-106926467
Sequence TTTTATAGGCAGGAACTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978273973_978273980 27 Left 978273973 4:106926445-106926467 CCTTTCAGTTCCTGCCTATAAAA 0: 1
1: 0
2: 0
3: 26
4: 254
Right 978273980 4:106926495-106926517 GTATGAGGCAGTGAATTATTTGG No data
978273973_978273978 12 Left 978273973 4:106926445-106926467 CCTTTCAGTTCCTGCCTATAAAA 0: 1
1: 0
2: 0
3: 26
4: 254
Right 978273978 4:106926480-106926502 AACATTTCCAGAACAGTATGAGG 0: 1
1: 0
2: 0
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978273973 Original CRISPR TTTTATAGGCAGGAACTGAA AGG (reversed) Intronic
900005874 1:50613-50635 TTTTATGAGAAGGAAATGAAAGG - Intergenic
900168795 1:1256122-1256144 TTTTCTAGGAAGGAAGGGAAGGG + Exonic
903095063 1:20964170-20964192 TTTAATAGGTAAGAACTAAAAGG + Intronic
903756958 1:25668968-25668990 TTTTATGGGGAGAAACTGAAAGG + Intronic
903839815 1:26230795-26230817 TGTCATAGGAGGGAACTGAAGGG + Intergenic
905505190 1:38473730-38473752 ATTTATAGACAGAAAATGAATGG + Intergenic
905550525 1:38834415-38834437 TGTTATAATGAGGAACTGAATGG - Intergenic
905777180 1:40676127-40676149 TTGTAAAGACTGGAACTGAAAGG - Intergenic
906264051 1:44415273-44415295 TTCTGTAGGGAGGACCTGAAAGG - Intronic
907516109 1:54994445-54994467 TTTACTGGGCAGGCACTGAAAGG + Intergenic
907616418 1:55931261-55931283 TTTTATTGGCAGAACCTGATGGG + Intergenic
908365048 1:63413389-63413411 TTTTGAAGGCAAGAAGTGAATGG - Intronic
908499958 1:64733281-64733303 TCTCAGATGCAGGAACTGAAGGG + Intergenic
908614448 1:65903265-65903287 TTTGATATGCAGGAAATGAGAGG - Intronic
909244167 1:73255934-73255956 TTTTACATGCAGAAGCTGAAAGG + Intergenic
909952658 1:81737805-81737827 TTTTAAAGGCAAGACCTGAAAGG - Intronic
910347193 1:86253599-86253621 TCTTAAAGGAAGGAACTGGAGGG - Intergenic
915842919 1:159231000-159231022 GTTTATAAGGAAGAACTGAAAGG + Intergenic
917691287 1:177472070-177472092 GTTTATATGCAGGAGCTGCAGGG - Intergenic
919208769 1:194453091-194453113 TTTTATTGGCAGGTACTGGTTGG - Intergenic
919877297 1:201879050-201879072 TTTTATTGGAGTGAACTGAAAGG + Exonic
920287915 1:204894631-204894653 TTTTAAAGGGAGGAGCTGAAGGG - Intronic
921481642 1:215670906-215670928 TTTTACAGGCAGGTGCTGACGGG + Intronic
923064780 1:230507812-230507834 TTCTATAGGAAGGAACTGGCAGG + Intergenic
924723695 1:246647071-246647093 TTGTATAGGAAGGAAAAGAAGGG - Intronic
1063594986 10:7426502-7426524 GTTTATATGTAGGAACTAAAGGG - Intergenic
1064363616 10:14687705-14687727 TTTTAGAGGCAGAAATGGAATGG - Intronic
1065110041 10:22431552-22431574 TAATATTGGCAAGAACTGAAAGG - Intronic
1065142108 10:22728089-22728111 TGTTATAGATAGGTACTGAAAGG + Intergenic
1067410410 10:46059632-46059654 TTTATTAGGCAGAAACTTAAGGG + Intergenic
1067424284 10:46192147-46192169 TTTTGTAGGCAAAAACTGGATGG + Intergenic
1067934402 10:50596629-50596651 TTTTCTAGTCAGTAACAGAAAGG - Intronic
1068420864 10:56790789-56790811 TTTTATAGGGAGGATCTGAGAGG - Intergenic
1068615706 10:59113612-59113634 TTTTTTAGGCAAGACCTGAGAGG + Intergenic
1068638457 10:59374431-59374453 TTTTATGGGAGGGAGCTGAAGGG + Intergenic
1069328542 10:67262292-67262314 TTTTATATGCAGGATCAAAAGGG + Intronic
1069366155 10:67695999-67696021 CTTTATAGGAAGAAACAGAAAGG - Exonic
1069478033 10:68753158-68753180 TTTAAAAGAGAGGAACTGAAAGG - Intronic
1070542856 10:77429228-77429250 TGTTAGAGCCAGGAACAGAAGGG + Intronic
1073327084 10:102649396-102649418 TATTGGAGGCAGGAGCTGAAAGG + Intronic
1073534916 10:104268218-104268240 TTTGATAGGAAGGATTTGAAGGG - Intergenic
1073714476 10:106087257-106087279 TTTTTTAAGCAGGAAAGGAAAGG - Intergenic
1073809871 10:107141269-107141291 TTTTGTAGAGAGGAACTCAATGG + Intronic
1076002711 10:126924774-126924796 ATTTATAGACAGGCACTTAAAGG + Intronic
1078553876 11:12302042-12302064 TTTCTTAGGCAGGAACTTTAAGG + Intronic
1078990135 11:16637844-16637866 TTTTATAGGCAAGGCCTGGAAGG + Intronic
1080526816 11:33130576-33130598 TTTAATAAGCAGGTATTGAAAGG + Intronic
1081029440 11:38059829-38059851 TTTTCTATACAGCAACTGAAAGG - Intergenic
1081803613 11:45876983-45877005 TTTTAAAGGCAGGAACAGAGAGG - Intronic
1085080156 11:73627322-73627344 TATTATGGGACGGAACTGAATGG - Intergenic
1086015813 11:82166300-82166322 TAGTATTGGCAGGAACTGATTGG + Intergenic
1087209599 11:95433309-95433331 TTTCAGAGGAAGGAAGTGAAGGG - Intergenic
1087872411 11:103312828-103312850 TTTTATTGGGAAGAACTGACTGG - Intronic
1087956042 11:104289213-104289235 TTTTATAGTCAGGATCGAAAGGG - Intergenic
1090223726 11:125055398-125055420 TTTCACAGGCAAGGACTGAAAGG - Intergenic
1093845557 12:23966310-23966332 GTATTTAGGCAGAAACTGAAAGG + Intergenic
1095411369 12:41928357-41928379 TTTTTTAGGCAGGGACAGATTGG - Intergenic
1096739824 12:53684868-53684890 CTGTATAGGGAGGGACTGAAAGG + Intergenic
1100275723 12:93070090-93070112 TTTTATAGGCTGATTCTGAAAGG - Intergenic
1100935226 12:99657045-99657067 TTTTATAGACAGCAACTGATTGG - Intronic
1101654733 12:106709888-106709910 TTTTATGGGCAGGAACTTCAAGG - Intronic
1101682809 12:106986043-106986065 TTGGGAAGGCAGGAACTGAACGG + Exonic
1103860434 12:124008238-124008260 TTTTAATGGAAAGAACTGAAGGG - Intronic
1106659449 13:31783657-31783679 TTTTATAGGCAAAAACTTAAAGG + Intronic
1107767713 13:43755517-43755539 TTTTATAGGAAAGAAATGTAAGG - Intronic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1108422753 13:50267385-50267407 TTTTACAGGCCGAAGCTGAACGG + Intronic
1109118401 13:58421149-58421171 TTTTATTGCCAGAAAATGAATGG + Intergenic
1109199557 13:59414980-59415002 TTTTAAAAGCAGTAACTAAAAGG - Intergenic
1110337897 13:74353278-74353300 TTTTAAAGGCAAGCAATGAAGGG - Intergenic
1110876208 13:80513496-80513518 TTTTATAATCAGGAACTCACTGG - Intergenic
1111557222 13:89896301-89896323 TTGTAAAGGCAGGAACTGGGAGG - Intergenic
1111923506 13:94438260-94438282 TGTTAATGGCAGGAACTGAGAGG + Intronic
1113830735 13:113293599-113293621 TTTTTTAAGTAGTAACTGAAAGG + Intergenic
1119221226 14:72909310-72909332 TTTTACTGGCAGGAAATAAAAGG + Intergenic
1124871557 15:33548426-33548448 TTTTATAGTCAGCTACTGCAAGG - Intronic
1125069864 15:35541173-35541195 TTTTATAGGAAGAAATGGAAAGG - Intronic
1125161909 15:36653945-36653967 TTTCATAGGAAAGCACTGAAGGG - Intronic
1126852238 15:52804509-52804531 TTTTAAAGACAGGAACAGGATGG + Intergenic
1127063678 15:55214564-55214586 TTTTAGAGTCAGGAAATAAAAGG - Intronic
1127300692 15:57650777-57650799 TTTTCTAGGCAGGGATTGAATGG + Intronic
1127572555 15:60258412-60258434 ATTTATAGACAGGAAAAGAAAGG - Intergenic
1128733404 15:70035566-70035588 TCGTATGGGCAGGAACTGAGGGG - Intergenic
1130374948 15:83320744-83320766 GTTTATGGGCAAGAAGTGAATGG + Intergenic
1131630292 15:94169118-94169140 TTTTATTGACAGCAACTAAATGG + Intergenic
1131932769 15:97463523-97463545 GTATATAGAGAGGAACTGAATGG + Intergenic
1132447640 15:101940310-101940332 TTTTATGAGAAGGAAATGAAAGG + Intergenic
1134841030 16:17401786-17401808 TTTTTTAAGCAGGAGCTGACTGG - Intronic
1136100631 16:27992924-27992946 TTCTGTAGGCAGGGACTGTAGGG - Intronic
1136385203 16:29920956-29920978 TTGTAGGGGCAGGAACTGGAAGG + Intronic
1136654819 16:31703464-31703486 TGCTATAGGCAGGAAATGGAGGG + Intergenic
1137298523 16:47122164-47122186 TTTTATTGGAAAGAACTGCAGGG - Intronic
1137735798 16:50722226-50722248 TGTTATGGGCAGGTACTGGAGGG + Intronic
1138144565 16:54596823-54596845 TTTTATAGGCAGAGAACGAAAGG + Intergenic
1138985952 16:62328707-62328729 TGTTATAGGCAGAACATGAAAGG - Intergenic
1141335345 16:83149455-83149477 TCATATGGGCAGGAACTGAGAGG + Intronic
1143458052 17:7080441-7080463 ATGTAGAGGCAGGAAGTGAAAGG - Intergenic
1144712354 17:17409998-17410020 TGTGGTAGGCAGGAACTGAGAGG + Intergenic
1144995838 17:19267848-19267870 TTTTATAGTAAGGATTTGAATGG + Intronic
1149333090 17:55606664-55606686 TTTTAGTGGCAGTAACTGACAGG - Intergenic
1149720667 17:58840966-58840988 TTTTATAGGCTGGACCTGGAGGG + Intronic
1151533066 17:74720092-74720114 TTTTGCAGGTAGGAACTGGAGGG + Intronic
1154050873 18:10956187-10956209 TTTTGTAATCAGCAACTGAAGGG - Intronic
1154237045 18:12615840-12615862 TTCTAAAGGCAGGAAATGAAAGG - Intronic
1154948813 18:21188021-21188043 TTTCACAGACAGGAACTCAAAGG + Intergenic
1155388006 18:25302050-25302072 TTTTATAGAAAGGAACTTGAAGG + Intronic
1155783274 18:29866843-29866865 TTTTAAATGCATGAACTGTATGG + Intergenic
1156936713 18:42718116-42718138 TTTTAAGGGGAGGAACAGAAAGG - Intergenic
1158493539 18:57932164-57932186 TTTTTTAGGGACGAACTAAATGG - Intergenic
1158553579 18:58457688-58457710 TTTCATAAGAAGAAACTGAAAGG - Intergenic
1158983335 18:62787478-62787500 TTTTGAAGGGAGGAACTGAGGGG + Intronic
1159696672 18:71566293-71566315 TTTGATAGGAAGGACCTAAAGGG + Intergenic
1159760750 18:72422621-72422643 TGTTAAAGGCAGGAAAGGAATGG + Intergenic
1160637631 19:92219-92241 TTTTATGAGAAGGAAATGAAAGG - Intergenic
1161828804 19:6588122-6588144 CTTGTTAGGAAGGAACTGAACGG + Intronic
1164212545 19:23112417-23112439 TTTTATAGGTAAAAAATGAAAGG + Intronic
1165172617 19:33904875-33904897 TTTTCTAGCCAAGAACTGACTGG + Intergenic
1166164172 19:40975344-40975366 TTCTAAAGGAGGGAACTGAAGGG - Intergenic
1168193623 19:54757366-54757388 TTATAGGGGAAGGAACTGAAGGG + Intronic
1168234615 19:55054281-55054303 TTTTCTAGTCTGGCACTGAAAGG - Intronic
926211140 2:10870399-10870421 TTTTAGAGGTCAGAACTGAAAGG + Intergenic
926811533 2:16759175-16759197 TTTTATAGGCAAGCTCAGAAAGG + Intergenic
928849706 2:35730347-35730369 TTTTATAGATAGGAAGTAAAAGG + Intergenic
929179664 2:39023187-39023209 TTTTATAGTCAGCAAATGAAGGG - Exonic
930956754 2:57211984-57212006 TTTTATAAGCAGGAAATCCAAGG - Intergenic
931091894 2:58895246-58895268 TTTAATAGGCAAGAAGTGAAGGG + Intergenic
931184637 2:59938170-59938192 TTTTATTTGCAGGACCAGAATGG + Intergenic
932742336 2:74301318-74301340 TCTGTAAGGCAGGAACTGAAGGG + Intronic
935184694 2:100721636-100721658 CTTTATAGGCTGGAGCGGAAGGG - Intergenic
935913642 2:107925164-107925186 ATTTAAAGGCAGGAAAAGAAGGG + Intergenic
937072939 2:119078361-119078383 TTTTGAAGGCAGGATCTGGATGG - Intergenic
939295700 2:140261780-140261802 ATTTACATGAAGGAACTGAACGG + Intronic
941180171 2:162250130-162250152 TTTTGTAGAAAGGAACTCAAGGG + Intergenic
941381078 2:164792947-164792969 TTTTATGGGGAGGAACTGTAGGG - Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941870898 2:170384663-170384685 TTTCATAGGGAGGAAGTAAATGG + Intronic
942494392 2:176524206-176524228 TTTTATAAGACAGAACTGAAAGG + Intergenic
945681862 2:212923888-212923910 TTTTATAGACAGGCACTAATAGG - Intergenic
946060827 2:216940074-216940096 TTTTTAAGGCAGAAATTGAAAGG + Intergenic
947480200 2:230492223-230492245 TTTTATAGGTAGGAATCCAAAGG - Intronic
947862011 2:233367163-233367185 TGTTATAGGCAGGTAGGGAACGG - Intronic
1169331816 20:4722194-4722216 TTTCATAGGCAGAAGCTTAAAGG - Intronic
1170149715 20:13216875-13216897 TTTTATGGGCTAGATCTGAAAGG + Intergenic
1170185772 20:13588784-13588806 TTTTTTTGGCAGAAACTGACAGG + Intronic
1172775633 20:37405063-37405085 TTTCATAGGCAGGCACTGCTTGG - Exonic
1173169810 20:40714925-40714947 CTTTACAGGCAGTAACTGACTGG + Intergenic
1173677302 20:44847209-44847231 TTTTTTAGGGATGGACTGAATGG + Intergenic
1174536093 20:51252565-51252587 TTTTATAGGGTGGAGCTGGAAGG - Intergenic
1174884740 20:54321169-54321191 TTTTATAGGCATGTGCAGAAAGG + Intergenic
1176005201 20:62858482-62858504 TTTTATAGGGAGGAAAAGGAAGG + Intronic
1176874295 21:14113062-14113084 TTTTGAAAGCAGGACCTGAAAGG + Intronic
1177418227 21:20822384-20822406 TTTCATAAGCAGGAAGTGACAGG + Intergenic
1177761726 21:25409174-25409196 TTTTACAGGCAGGGGATGAAGGG + Intergenic
1178041144 21:28642298-28642320 CTTCATGGGCAGGAACTGGAGGG + Intergenic
1181960961 22:26621613-26621635 TTTTATAGGCAGAAATTGAGGGG + Intergenic
1182426429 22:30275613-30275635 TTTTATAGCCAGGTTTTGAAGGG + Intergenic
949548259 3:5091195-5091217 TTTTATATCCAAGAACTTAAAGG + Intergenic
949590241 3:5486678-5486700 TTTTATAAATAGGAACTGCAAGG - Intergenic
950242257 3:11381504-11381526 TTTTATAAACAGTATCTGAAAGG - Intronic
950501248 3:13365328-13365350 TTTTACAGGCAGGGAATGTAAGG + Intronic
951824164 3:26848697-26848719 TTCAATAGGCAGGGACTGAAGGG - Intergenic
952640372 3:35587105-35587127 TTTTATATACAGTAACTCAAAGG + Intergenic
953549738 3:43892517-43892539 TTTTATGACCAGGAAATGAACGG - Intergenic
958726762 3:97915323-97915345 TTTTATAGGCAGCAAAAGTAAGG - Intronic
959346868 3:105206512-105206534 TTATTTAGGGATGAACTGAATGG + Intergenic
960536403 3:118819424-118819446 TTTTAAAGGCAGTGATTGAAAGG + Intergenic
960922712 3:122763958-122763980 TTTAACAGGCAGAAATTGAAGGG - Intronic
962549629 3:136476396-136476418 TGCAATAGGCAGTAACTGAAGGG + Intronic
963912721 3:150828526-150828548 TCTTATAGACAGGAGCTGATGGG + Intergenic
966355404 3:179073458-179073480 TTACAGAGGCAGGAAATGAAGGG - Intergenic
968931636 4:3582456-3582478 TTTTATTGTCATGAAGTGAATGG + Intronic
970159780 4:13176898-13176920 TTTTATATACAGGATCTGACTGG - Intergenic
971851925 4:31995201-31995223 TTATAAAGGCAGGAACTGCAGGG + Intergenic
972090882 4:35281925-35281947 TCTTTTTGGCAGAAACTGAAAGG + Intergenic
973155447 4:46945899-46945921 TTTTCTAGGAAGAGACTGAAAGG + Intronic
973236935 4:47915106-47915128 TTATATAGGCAGAAACTGAGAGG + Intronic
973851025 4:54961802-54961824 TTTTATAAGAAGGAAATAAAGGG + Intergenic
976429704 4:84948078-84948100 TTTTATAGGAAGTAAATGAAAGG + Intronic
976957774 4:90923827-90923849 TTTTATATGCAGACACTTAAAGG + Intronic
977514445 4:98003232-98003254 TTTTACAGGCAGAAGCTGGAAGG + Intronic
978273973 4:106926445-106926467 TTTTATAGGCAGGAACTGAAAGG - Intronic
978669378 4:111228017-111228039 TTTTATTGGCAGGATGAGAAGGG - Intergenic
978675282 4:111307065-111307087 ATATATAGGCTGAAACTGAAGGG - Intergenic
980373988 4:131918490-131918512 TTTAATTGGCAGAAAATGAAGGG + Intergenic
980773896 4:137414627-137414649 TATTATGGGTAGGAACTGAGAGG + Intergenic
982887811 4:160805042-160805064 TTGTAAAGGCAGGAAATTAATGG + Intergenic
983192644 4:164771116-164771138 TTTTATAGTCAAGAATTGATGGG - Intergenic
984023699 4:174518365-174518387 TTCTATAAGCAGTAACTTAATGG + Intronic
987564919 5:19572426-19572448 TTTTTTTGGCAGGAACAGAATGG + Intronic
988824289 5:34918948-34918970 TTTTACAGGCAAGAACAGTATGG + Intronic
989217427 5:38919752-38919774 TTTTAATAGCAGGAACTGAAGGG - Intronic
991169646 5:63606637-63606659 TTTTAAAAGCAAGACCTGAAAGG - Intergenic
992709979 5:79442570-79442592 TTTTATTGGCATGAAATGGAAGG - Intronic
996074525 5:119174750-119174772 TATAAAAGGCAGTAACTGAAAGG - Intronic
998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG + Intronic
1000399210 5:160807925-160807947 TTTTAAAGGCAGGTACAAAAAGG - Intronic
1000750300 5:165087153-165087175 TTGTATAGGCTGCAATTGAATGG + Intergenic
1003225086 6:4196946-4196968 TTCTTTAGGGAGGAACTAAATGG + Intergenic
1004025383 6:11813240-11813262 TCTTAAAGACAGGCACTGAATGG + Intergenic
1005071999 6:21870564-21870586 TCTTTGAGGCAGGGACTGAAGGG + Intergenic
1006830454 6:36964905-36964927 AGTTATAGGAAGGAAATGAAGGG - Intergenic
1007109121 6:39302933-39302955 TTTTATAGGCAGGAACACTGAGG + Intronic
1010573641 6:77507426-77507448 TTTTATAGGCAGGAAAGCCATGG + Intergenic
1010824412 6:80455063-80455085 TTCTATATGCAGGAAATAAATGG - Intergenic
1011810149 6:91122176-91122198 TTTCACAGGCAGGAAATAAAAGG - Intergenic
1012329832 6:97971185-97971207 TTTTGAGGGGAGGAACTGAATGG + Intergenic
1012465488 6:99512834-99512856 TTTTATAAGGTGGAACTGTAGGG - Intronic
1014190124 6:118486437-118486459 TTTTATAAGAAAGAACTCAAAGG + Intronic
1014649336 6:124016938-124016960 TTTGATAGGCTTGAACTTAAAGG - Intronic
1015104556 6:129520730-129520752 TTTTATGGGGAGGAACTAGAAGG + Intergenic
1016527017 6:145013052-145013074 TTTTATGTGTAGGAGCTGAATGG + Intergenic
1017642235 6:156505463-156505485 TTTTACAGGCAGCCACTGTAAGG - Intergenic
1018299786 6:162388991-162389013 TTTTTTCTGGAGGAACTGAAAGG - Intronic
1019020394 6:168913080-168913102 TTGGATAGGCAGGAACAGGAGGG - Intergenic
1019090541 6:169528407-169528429 TTTTTCAGGCAGGAAGTGAGTGG + Intronic
1019796374 7:3052288-3052310 TTCTTTAGGCATGAACTCAATGG - Intergenic
1020897175 7:13954926-13954948 TTTTATTGGCATTTACTGAAAGG - Intronic
1021437935 7:20642499-20642521 TTTTCTAGGAAGGAAGTAAACGG - Intronic
1022921446 7:35019854-35019876 TTTTAAAGACAGAAACTAAAAGG - Intronic
1023238399 7:38115429-38115451 TTCTGTAGGCAGTCACTGAAGGG - Intergenic
1024193075 7:47032331-47032353 TTTAATAGGCAAGAAGTGAAGGG - Intergenic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024850914 7:53716035-53716057 TTTTCCAGACAGGAACTCAAGGG - Intergenic
1025640282 7:63360860-63360882 TTGCTTAGGCAGGGACTGAAAGG + Intergenic
1025642417 7:63387233-63387255 TTGCTTAGGCAGGGACTGAAAGG - Intergenic
1031047750 7:116912321-116912343 TTTTAAATGAATGAACTGAATGG - Intronic
1031844577 7:126789794-126789816 TTCTATAGAAAGGAACTTAATGG - Intronic
1033552878 7:142463440-142463462 TATTATAGGGAGGAAGAGAATGG + Intergenic
1033583183 7:142754835-142754857 TTTGATAGGGATGATCTGAATGG - Intronic
1033584725 7:142765731-142765753 TTTGATAGGAATGATCTGAATGG - Intergenic
1033586202 7:142776310-142776332 TTTGATAGGAATGATCTGAATGG - Intergenic
1034285964 7:149883170-149883192 TTTTTCAGACAGGAACTCAAAGG + Intergenic
1034875049 7:154718293-154718315 TTTTATAGAAAAGAACTCAAAGG - Intronic
1035904090 8:3490620-3490642 TTTTATAGCCAGGAAAAGACAGG + Intronic
1035922132 8:3689022-3689044 TTTTATAAGCAGGAATCTAAGGG + Intronic
1036207731 8:6817585-6817607 TTTCTCAGGCAGGAACTTAAAGG - Intronic
1037006044 8:13781334-13781356 TTTTGTAAGCAGGAACACAAAGG + Intergenic
1038205589 8:25461680-25461702 TTTTATCCCCAGCAACTGAAAGG - Intronic
1039184456 8:34900975-34900997 ATTAATAGGCAGGCACTGAATGG + Intergenic
1042309897 8:67369541-67369563 TCTCTTAGGCAGGAACTTAAGGG - Intergenic
1042448582 8:68918613-68918635 TGTTGGAGGCAGGAACTGAATGG + Intergenic
1042624729 8:70745150-70745172 TTTTATAGCCAAGAAATAAATGG + Intronic
1044070476 8:87753732-87753754 ATGTATAGGCAGCAACTGAGGGG - Intergenic
1045069943 8:98492602-98492624 TTTTTTTGGCAGGAATGGAATGG + Intronic
1045309819 8:100991419-100991441 TTTTACAGGGTGGAAGTGAAGGG - Intergenic
1045685205 8:104704304-104704326 TTGTTTAGGTAGGAACTCAAAGG - Intronic
1046623212 8:116550083-116550105 CTTTATGGGCATTAACTGAATGG + Intergenic
1047412030 8:124631657-124631679 TTTCATAGTCAGAACCTGAATGG - Intronic
1047611165 8:126522231-126522253 ATTTGCAGACAGGAACTGAAGGG + Intergenic
1047883122 8:129218385-129218407 TTTTATAGGCACAAAATGGAGGG - Intergenic
1048158360 8:131986130-131986152 TTTTATAGCAAGGTACTGAGGGG + Intronic
1049458045 8:142704260-142704282 TTCTTTAGGGATGAACTGAATGG - Exonic
1050621442 9:7456279-7456301 TTTTTTAGGCTGGGACTCAAAGG - Intergenic
1052901947 9:33800968-33800990 TTTGATAGGAATGATCTGAATGG - Intergenic
1054458489 9:65449471-65449493 TTTTATTGTCATGAAGTGAATGG - Intergenic
1055280179 9:74665309-74665331 TTTTAGGGGAAGGAACTTAAGGG + Intronic
1055749722 9:79491757-79491779 TTTTACAGGGAGGAAATGAATGG - Intergenic
1055877262 9:80958427-80958449 TCTGATAGGCAGGAAATGGATGG + Intergenic
1056303631 9:85268220-85268242 TTTGATTGGGAGGAAATGAAAGG - Intergenic
1056542043 9:87580237-87580259 TTTTAAAAATAGGAACTGAAAGG - Intronic
1185784535 X:2878944-2878966 TTTCATTCTCAGGAACTGAATGG + Intronic
1187474109 X:19594918-19594940 TTTTATTTGATGGAACTGAAAGG + Intronic
1187533222 X:20115260-20115282 TTTTATTTGAAGGAACTTAAGGG - Intronic
1187923598 X:24229955-24229977 TTTTAAAAGCAAGACCTGAAAGG - Intergenic
1188336057 X:28934391-28934413 CTTTAAAGGCATGAACTGTATGG - Intronic
1188341147 X:29003457-29003479 TTTTATAGGATGTAAATGAAGGG + Intronic
1189074542 X:37902617-37902639 CTTTCCTGGCAGGAACTGAAAGG + Intronic
1190525288 X:51323461-51323483 TTTAAAAGGCAGGGACAGAAGGG - Intergenic
1190791639 X:53706117-53706139 GTTTATAGGCAGGAAGAAAATGG + Intergenic
1192206879 X:69102188-69102210 TCTTAGAGGCAGAAAGTGAAAGG - Intergenic
1192337810 X:70236606-70236628 TTATTTAGGCAGGCACTGGAAGG + Intronic
1192797773 X:74438684-74438706 TTATCTAGGCAGAAACTGAAGGG - Intronic
1194348609 X:92796651-92796673 TCTTATAGGCAGCAGCTCAATGG - Intergenic
1194951001 X:100125790-100125812 CTTCATAGGCAGATACTGAAAGG + Intergenic
1196049544 X:111290363-111290385 TTTTCTAGGCAGGGAAAGAAGGG + Intergenic
1196315543 X:114218467-114218489 TTTTATATGCATGAAATAAAAGG + Intergenic
1196562878 X:117172335-117172357 TATTATAAGCAGCAAATGAAAGG + Intergenic
1198217706 X:134571105-134571127 TCTTATAGACAGGAAGAGAATGG + Intronic
1198971289 X:142283289-142283311 TTTCATAGGCAGCAAAAGAAGGG - Intergenic
1199930111 X:152509215-152509237 TTTCGTAGGCAGGAAAGGAAAGG + Intergenic
1200656936 Y:5913279-5913301 TCTTATAGGCAGCAGCTCAATGG - Intergenic