ID: 978274157

View in Genome Browser
Species Human (GRCh38)
Location 4:106928840-106928862
Sequence CTGCAGTTGCCAGTTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978274157 Original CRISPR CTGCAGTTGCCAGTTGCCAT TGG Intronic
900629777 1:3628160-3628182 CTGCAGGTGCTGGCTGCCATTGG + Intronic
901558276 1:10048835-10048857 CTGTAGTTGGCAGAAGCCATGGG + Intronic
904258810 1:29275222-29275244 CAGCAGTTGCCAGCTGCAAGTGG + Intronic
905536403 1:38725665-38725687 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
908924129 1:69232759-69232781 CTCCATTTGCCAGTAGTCATAGG + Intergenic
909732997 1:78919317-78919339 CTGCTGTTCCCACTTCCCATAGG + Intronic
910298138 1:85673517-85673539 TTGATGTTGCCAGTTTCCATTGG - Intronic
911032543 1:93505377-93505399 CTGCTGTGTCCAGTTTCCATTGG + Intronic
911299720 1:96157338-96157360 CTGCATGTGCCTGTGGCCATTGG + Intergenic
912003254 1:104860492-104860514 CTGCAGATGACAGATGTCATTGG + Intergenic
912239964 1:107896064-107896086 CTGCAGGTGCTTGTGGCCATGGG - Intronic
912392465 1:109313655-109313677 CTGGAGTTGGCAGATGCCCTGGG + Exonic
912393411 1:109320687-109320709 CAGAAGGTGCCAGGTGCCATGGG - Intronic
913714973 1:121524158-121524180 TTGCAGTTGGCAGTATCCATGGG + Intergenic
917427638 1:174931686-174931708 GTGCATTTACCACTTGCCATCGG + Intronic
918140410 1:181714926-181714948 CTTCTCTTGCCAGTGGCCATGGG - Intronic
919273124 1:195376765-195376787 CTGGCAATGCCAGTTGCCATGGG + Intergenic
922238664 1:223740420-223740442 CTGCTGTGTCCAGTTTCCATTGG + Intronic
922976700 1:229790833-229790855 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
923309199 1:232719219-232719241 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
923916080 1:238506366-238506388 ATGCATTTGCCAGTTTCCCTTGG - Intergenic
924956616 1:248934408-248934430 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1064122430 10:12631525-12631547 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1065952194 10:30662475-30662497 CTGCAGTTCCCTGTTTCCACAGG + Intergenic
1067458872 10:46442834-46442856 GTGCTGCTTCCAGTTGCCATGGG + Intergenic
1067628322 10:47941801-47941823 GTGCTGCTTCCAGTTGCCATGGG - Intergenic
1069213625 10:65792380-65792402 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1069450829 10:68516254-68516276 CTGCTGTGTCCAGTTTCCATTGG + Intronic
1069628734 10:69884139-69884161 CAGCAGATGACAGTTCCCATTGG - Intronic
1071977078 10:90965856-90965878 CTGCTGATGCCAGTGCCCATGGG - Intergenic
1072317154 10:94214235-94214257 CTGCAGTCCCCAGATGCCCTGGG - Intronic
1072611100 10:97018247-97018269 CTGCTCCTGCCAGGTGCCATGGG - Intronic
1075325401 10:121527894-121527916 CAGCAGCCGCCACTTGCCATAGG + Intronic
1075579827 10:123608963-123608985 CAGCAGTTGCCAGGGGCAATGGG - Intergenic
1076962510 10:133776089-133776111 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1078221892 11:9358202-9358224 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
1079274863 11:19025868-19025890 CTGCAATTGACAGTTGCTAGAGG + Intergenic
1082908658 11:58343921-58343943 CTGCAGTTGCCATCTTCTATGGG - Intergenic
1083265558 11:61545303-61545325 CTTCACTTGCCAGATGTCATGGG - Intronic
1083886342 11:65575183-65575205 CTGCAGGTGTCAGCTGCCCTGGG - Intergenic
1084437797 11:69154554-69154576 CTGGGGATGCAAGTTGCCATCGG - Intergenic
1088495206 11:110425334-110425356 CAGCAGTTGCCAGTAGCTCTGGG - Intergenic
1090329415 11:125918975-125918997 CAGTAGTTGCCAGGGGCCATGGG - Intronic
1091621690 12:2093835-2093857 CTGCAGTTGCAGGCTGCCAGGGG + Intronic
1095450163 12:42322754-42322776 ATGGAGTTGATAGTTGCCATGGG - Intronic
1095629944 12:44364109-44364131 TTACATTTGCCAGTTGCCAAAGG - Intronic
1095784371 12:46093475-46093497 CTGCAATTTCCACTGGCCATGGG - Intergenic
1097611958 12:61834343-61834365 CTGCTGTTGCCACTTGCTGTTGG + Intronic
1102292436 12:111712100-111712122 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1102478808 12:113206487-113206509 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1102595544 12:113989706-113989728 CTCCAGTTTCCAATTCCCATAGG - Intergenic
1104761781 12:131301077-131301099 CTGCAGATCCCAGCTGCCCTGGG - Intergenic
1106332040 13:28748276-28748298 CTGAAGTTGCCAGATGCCTATGG - Intergenic
1107759128 13:43657542-43657564 CTGCAGCAGCCTGTTGACATGGG - Intronic
1108478837 13:50846425-50846447 CAGCAGCTGCTAGTAGCCATAGG - Intergenic
1109195592 13:59374847-59374869 CTCCGGTTCCCAGTTGCCCTGGG - Intergenic
1109605314 13:64686840-64686862 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
1111000000 13:82165833-82165855 CTGCAGCTGCAAGATGCCCTGGG + Intergenic
1115246147 14:31297928-31297950 TTGCAGTTTCAAGTTGCTATAGG - Intronic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1117180261 14:53184135-53184157 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1121015121 14:90544377-90544399 CTGCAGTGGCCAGCTACCCTCGG - Intronic
1121078326 14:91087720-91087742 CTGCTGTGCCCAGTTTCCATTGG - Intronic
1121083156 14:91125101-91125123 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1121183421 14:91946723-91946745 CTGCAGTTCCCACTTCTCATTGG + Intronic
1121672102 14:95718304-95718326 CTGTGGTTGCCATTTGCCAGAGG + Intergenic
1122358915 14:101145537-101145559 CTGCAGCTGCCACTTACCATTGG - Intergenic
1123186590 14:106523652-106523674 CTGCAGTTCCCATGTGTCATGGG + Intergenic
1123838060 15:24216426-24216448 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
1123922290 15:25078849-25078871 CTGCACTTCCCAGGTGGCATGGG + Intergenic
1124516720 15:30372775-30372797 CTGCAGTTGCCAGTTCCTCTTGG + Intronic
1124726198 15:32157956-32157978 CTGCAGTTGCCAGTTCCTCTTGG - Intronic
1132296250 15:100736869-100736891 CTCCAGCTCCCAGTTGCCCTGGG + Intergenic
1133546605 16:6813761-6813783 CTGCAGGTGCCTGCTGCCATTGG - Intronic
1134803056 16:17103429-17103451 CTGTAGTTGGCAGATGCTATAGG - Exonic
1137039279 16:35595056-35595078 CTGCAGTGTCCAGTTTCCATTGG + Intergenic
1137039844 16:35600311-35600333 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1138525953 16:57607357-57607379 CTGCAGTCGCCTGGGGCCATCGG + Intergenic
1138711610 16:58976671-58976693 CTGCAGTTGCCTCTTGACCTGGG - Intergenic
1139273076 16:65701395-65701417 CTTCAGATACCAGTTGCAATGGG - Intergenic
1140528664 16:75645771-75645793 CGGGAGTTGCAAGTTGCCGTGGG + Intronic
1140785418 16:78336650-78336672 TTCCAGCTGCCTGTTGCCATGGG + Intronic
1141064719 16:80904731-80904753 CTCCAACTGCCACTTGCCATTGG + Intergenic
1141486227 16:84342083-84342105 CTGAAGTGGCCGGCTGCCATCGG - Intergenic
1144024072 17:11262222-11262244 CTGCAGTTGTCACTTTTCATGGG + Intronic
1145846870 17:28046622-28046644 CTGCAGTTCACATTTGCCAGAGG + Intronic
1149575560 17:57709574-57709596 CTGGAGTTGCCAGTGGTGATGGG - Intergenic
1151346834 17:73507491-73507513 CTCCAGTGGCCAGCTGCCCTCGG + Exonic
1152951624 17:83237753-83237775 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1155627946 18:27858127-27858149 CTCCAGTGGCCAGTGGCCAGTGG - Intergenic
1160224759 18:77003982-77004004 CTGCTGGTTCCAGTTTCCATGGG - Intronic
1163019398 19:14474456-14474478 CTGCCCATGGCAGTTGCCATGGG + Intronic
1163169167 19:15518872-15518894 CTGCAGTGGCCCGTTCCCACTGG - Intronic
1163210688 19:15837521-15837543 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1164062239 19:21685550-21685572 GTGCATCTGCTAGTTGCCATTGG + Intergenic
1164610972 19:29631492-29631514 ATGCAGTTCCCAGTTCGCATGGG + Intergenic
1165294742 19:34917439-34917461 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1167317146 19:48771090-48771112 CTGCTGGTGCCAGCTGCCAAGGG - Intergenic
1167535989 19:50051830-50051852 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1168500482 19:56888630-56888652 CTGCTGTTTCCAGCTGCAATGGG - Intergenic
1168727655 19:58596793-58596815 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
925574862 2:5349902-5349924 CTCCAGTTCCGAGGTGCCATAGG - Intergenic
926989275 2:18660039-18660061 TTTCAGTTGCCAGGTGCCAGAGG - Intergenic
931404106 2:61959876-61959898 CTGCTGTGTCCAGTTTCCATTGG + Intronic
931404294 2:61961264-61961286 CTGCTGTGTCCAGTTTCCATTGG + Intronic
931561699 2:63568624-63568646 CTGCTGTGTCCAGTTTCCATTGG + Intronic
933919524 2:87030627-87030649 CTGAAGTTGCCTTTTGCTATGGG + Intergenic
933925789 2:87090552-87090574 CTGGGGTTGCGGGTTGCCATAGG + Intergenic
934003470 2:87739275-87739297 CTGAAGTTGCCTTTTGCTATGGG - Intergenic
936095247 2:109526248-109526270 CTGCTGTTGCCTGTGGCCCTGGG + Intergenic
936570903 2:113614401-113614423 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
937157187 2:119729511-119729533 CTTCAGTTGTGAGCTGCCATTGG + Intergenic
937301496 2:120845494-120845516 CTGCAGCTGCCAGTTGGCTGGGG + Intronic
937726591 2:125174523-125174545 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
938747637 2:134294939-134294961 CTGCTGTGTCCAGTTTCCATTGG - Intronic
942354962 2:175100841-175100863 CTGCTGTGTCCAGTTTCCATTGG - Intronic
944304848 2:198167518-198167540 ATAGAGTTGCCTGTTGCCATGGG - Intronic
947513943 2:230784882-230784904 CTGCTGTGTCCAGTTTCCATTGG + Intronic
1168900988 20:1364777-1364799 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1169664057 20:8014896-8014918 CTGCAGTTCCCAGTTCTCCTGGG - Intronic
1170050027 20:12132141-12132163 CAGTAGTTGCCAGGTGCTATAGG + Intergenic
1172923410 20:38507496-38507518 CTGTAGCTCCCAGCTGCCATGGG - Intronic
1173102489 20:40099801-40099823 TTGATGTTGCCATTTGCCATAGG - Intergenic
1177604255 21:23358324-23358346 CTGCTGTATCCAGTTTCCATTGG + Intergenic
1178776874 21:35560138-35560160 CTGCATATGCAATTTGCCATTGG + Intronic
1179726343 21:43343478-43343500 CTGAAGCTGCCAGTGGCCCTGGG - Intergenic
1180147800 21:45930932-45930954 CAGCAGTTTCCAGCTTCCATGGG + Intronic
1180263094 21:46688595-46688617 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1182537718 22:31017863-31017885 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1184220443 22:43096510-43096532 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
1184830103 22:46979948-46979970 CTGCAGATGCCTCTTCCCATGGG - Intronic
1185429299 22:50796479-50796501 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
952275630 3:31873026-31873048 CAGCAGTTGCCAGTTGCAGAGGG + Intronic
955322376 3:57983499-57983521 CTGCATTTACCAGTAGTCATTGG - Intergenic
957079793 3:75627302-75627324 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
960497746 3:118395156-118395178 CTGCAGTTGCCAGGATCCAGTGG + Intergenic
962962657 3:140325351-140325373 ATGGAGTTGCAAGTTGCCAGAGG + Intronic
968142551 3:196270674-196270696 CTGGTTTTGCCAGATGCCATTGG - Intronic
968373435 4:16707-16729 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
968891291 4:3370123-3370145 CTGCAGTGTCCTGTTGCCATGGG + Intronic
969084264 4:4643880-4643902 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
970837569 4:20428893-20428915 CTGCAGTTGTCAGTATCAATTGG + Intronic
971600523 4:28585849-28585871 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
972750398 4:41982323-41982345 CTGCAGTTTCCAGATCCCAGAGG + Exonic
974430180 4:61786561-61786583 CTGCTATTGCCATTAGCCATCGG + Intronic
976669131 4:87632557-87632579 ATGTAGTAGCCAGTAGCCATTGG - Intergenic
976797081 4:88946242-88946264 CTGCTGTGTCCAGTTTCCATTGG - Intronic
977162552 4:93653358-93653380 CTGGAGTTGGCAGGTGCCTTAGG - Intronic
977299377 4:95250424-95250446 CTGCAGTTTCTCGTTGGCATCGG - Intronic
977305567 4:95319286-95319308 CTGCACTTGACAGTTACCAGGGG - Intronic
977741827 4:100493475-100493497 CTGCAGTTCCCAGTAGCCCAAGG - Intronic
977988345 4:103412650-103412672 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
978274157 4:106928840-106928862 CTGCAGTTGCCAGTTGCCATTGG + Intronic
978622245 4:110644303-110644325 CTTCTGGTTCCAGTTGCCATTGG - Intergenic
979888784 4:126064055-126064077 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
984577579 4:181469100-181469122 TTGCAGTTGTCAATTGTCATGGG + Intergenic
984649674 4:182257028-182257050 TTGCAGTTTGCAGCTGCCATAGG + Intronic
984833055 4:183993665-183993687 CTTCAGTTGACTATTGCCATCGG + Intronic
985465742 4:190193569-190193591 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
987517745 5:18935354-18935376 CTGCATTTTGCAGTGGCCATAGG - Intergenic
987635684 5:20537854-20537876 CTGCATTTGCCTGTAGCAATTGG + Intronic
987901166 5:24013546-24013568 CTGCAGTTGGCAGATGTCAATGG + Intronic
989089694 5:37717325-37717347 CTGCAGTGGCCTTCTGCCATTGG + Intronic
989431903 5:41365401-41365423 CTGTAGTTGACATATGCCATAGG - Intronic
989962760 5:50436295-50436317 TTGCAGTTGGCAGTATCCATGGG - Intronic
990652627 5:57919220-57919242 CTGCAATTGCCTATTGCCATAGG + Intergenic
990731196 5:58811208-58811230 CCACAGTTGCCATTTGCCCTTGG - Intronic
992612355 5:78518560-78518582 GCGCAGCTGCCAGTAGCCATAGG + Intronic
992889240 5:81188785-81188807 CTGCTGCTGCCATTTGCTATCGG - Intronic
993387131 5:87273574-87273596 CTGCAGTAGCAAGTGGCCATTGG + Intronic
995134423 5:108665629-108665651 TAGCAGTTGTAAGTTGCCATTGG + Intergenic
996233210 5:121092053-121092075 CTGAGGTGGCCAGTTGCCAGTGG - Intergenic
996713483 5:126567224-126567246 CTGCTGTGTCCAGTTTCCATTGG - Intronic
997417542 5:133740671-133740693 CTGCATCTGCCAGTGGCCAGGGG + Intergenic
997698000 5:135876871-135876893 CTCCAGTTCCCAGTTGGCTTGGG + Intronic
999833852 5:155347969-155347991 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
1001749086 5:174115039-174115061 TTGCAGTTTCCAGTTGCCTCAGG + Intronic
1004896674 6:20154953-20154975 TTGGACTTTCCAGTTGCCATTGG - Intronic
1008038430 6:46772044-46772066 CTGTAGTAGCCAGTGGCCTTTGG + Intergenic
1008682482 6:53887833-53887855 CTGCAGATGCCGGTTGGCATGGG + Intronic
1008928420 6:56911519-56911541 CTGCAGTAGCGAGATGCCGTAGG - Intronic
1013403188 6:109818648-109818670 CTGCAGTTTCCAGCGTCCATTGG + Intronic
1013634757 6:112018669-112018691 GTGAGTTTGCCAGTTGCCATGGG - Intergenic
1019873953 7:3792253-3792275 CTGCAATTGCCTGAGGCCATGGG + Intronic
1024794320 7:53003984-53004006 CTGGAGTTCCCAGTGGGCATGGG + Intergenic
1026066277 7:67076205-67076227 CTGCTGTTACCAGTTTCCATTGG - Intronic
1026710650 7:72736136-72736158 CTGCTGTTACCAGTTTCCATTGG + Intronic
1026880223 7:73903026-73903048 CCGGTGTTGCCAGGTGCCATGGG - Intergenic
1027358058 7:77378965-77378987 CTCAAGTTGCAAGTTACCATCGG - Intronic
1029686683 7:102153338-102153360 CTGGTGTTGCCAGTGGCCAAAGG - Intronic
1032125981 7:129193179-129193201 CTGCAGCTGGCAGTGGCGATAGG + Intronic
1032876566 7:136044819-136044841 ATGCAGTTGCCAGTGCTCATGGG - Intergenic
1034530965 7:151696319-151696341 CTGATGCTACCAGTTGCCATTGG - Intronic
1034947576 7:155273253-155273275 CTGCTGTTTCAAGCTGCCATTGG + Intergenic
1035272938 7:157731076-157731098 CTGCAGTTCCCAGCAGCCTTAGG + Intronic
1039748784 8:40457589-40457611 CAGCAGGAGCCAGTTGCTATGGG + Intergenic
1039961746 8:42253818-42253840 CTGCTGTGCCCAGTTTCCATTGG + Intergenic
1043102036 8:76059339-76059361 TTGAAGTTGTAAGTTGCCATTGG - Intergenic
1046069338 8:109231946-109231968 CTGCCTTTGACAGTTGCCTTTGG + Intergenic
1050191465 9:3030843-3030865 CTGCAGCTACCAGTTACCTTGGG - Intergenic
1052598303 9:30591475-30591497 CTGCTGTTGACAATGGCCATAGG + Intergenic
1053173879 9:35908931-35908953 GTGCACTTTCCAGTTACCATGGG - Intergenic
1053524451 9:38814567-38814589 TTGCACTTGTCTGTTGCCATTGG + Intergenic
1054196686 9:62038976-62038998 TTGCACTTGTCTGTTGCCATTGG + Intergenic
1054641719 9:67549709-67549731 TTGCACTTGTCTGTTGCCATTGG - Intergenic
1056744388 9:89287447-89287469 CTTCAGTTGCCAGCTACAATGGG - Intergenic
1057989762 9:99756420-99756442 CTGCAAACGACAGTTGCCATGGG + Intergenic
1058584103 9:106488134-106488156 CTGTAGTAGCCAGCTGCCCTAGG - Intergenic
1061470093 9:130817541-130817563 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1061501477 9:131005524-131005546 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
1186719016 X:12282521-12282543 CTGCAGCTGCCACGTGCCACAGG - Intronic
1187230242 X:17414949-17414971 CTGCAGTTCTCTGTTGCCCTTGG + Intronic
1188157474 X:26757219-26757241 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
1189823287 X:44891732-44891754 CTGCCGTGTCCAGTTTCCATTGG + Intronic
1189825647 X:44913996-44914018 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1189964631 X:46359948-46359970 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1191605436 X:63057440-63057462 CTACAGTGGCCAGATGCCAAAGG - Intergenic
1191846949 X:65554004-65554026 CTGCTGTGTCCAGTTTCCATGGG - Intergenic
1192573972 X:72228135-72228157 CTGCTGTGTCCAGTTTCCATTGG - Intronic
1193089717 X:77481393-77481415 CTGGTTTTGCCAGTTACCATAGG + Intergenic
1193812590 X:86068983-86069005 CTGCTGTGTCCAGTTTCCATTGG - Intergenic
1194288091 X:92036355-92036377 CTACAATTGCCACTTGTCATGGG + Intronic
1195495378 X:105525884-105525906 CTGCAGATGCAGGGTGCCATGGG - Intronic
1195884307 X:109624117-109624139 CTCCAGCTTCCAGTTGCCTTAGG - Exonic
1197472720 X:126882850-126882872 CTGAGGTTGCAAGTTGCCAGTGG - Intergenic
1197907688 X:131443705-131443727 CTCCACTTGCCTGTTGCCACAGG + Intergenic
1198867872 X:141144907-141144929 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1199151707 X:144494681-144494703 CTGCTGTGTCCAGTTTCCATTGG + Intergenic
1199221907 X:145326396-145326418 CTGCTGTATCCAGTTTCCATTGG + Intergenic
1200134338 X:153867646-153867668 CTGGAGATGCCAGTTGGCCTGGG - Intronic
1200605613 Y:5260909-5260931 CTACAATTGCCACTTGTCATGGG + Intronic
1201668956 Y:16493481-16493503 CTGCTGTGTCCAGTTTCCATTGG - Intergenic