ID: 978275379

View in Genome Browser
Species Human (GRCh38)
Location 4:106942938-106942960
Sequence CAAGACCTGGAGAAGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978275379_978275382 0 Left 978275379 4:106942938-106942960 CCTGCCTACTTCTCCAGGTCTTG 0: 1
1: 0
2: 0
3: 20
4: 259
Right 978275382 4:106942961-106942983 TATTATACACTCCAGCTGTACGG 0: 1
1: 0
2: 0
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978275379 Original CRISPR CAAGACCTGGAGAAGTAGGC AGG (reversed) Intronic
901787480 1:11634326-11634348 CCAAACCTGGAGAGGGAGGCAGG + Intergenic
901873465 1:12152351-12152373 CAGGAGCTGGGGAGGTAGGCTGG + Intergenic
905414769 1:37796195-37796217 CTGGACCTCGAGGAGTAGGCAGG + Intronic
906513716 1:46425780-46425802 CAAGACCTGGAGAAATTCCCTGG - Intergenic
906561386 1:46760401-46760423 CAAGCCCAGGAGAAGTAGGAAGG - Intronic
908391941 1:63691123-63691145 GGAGACCAGGAGAAGGAGGCAGG + Intergenic
909355003 1:74697917-74697939 CAAGACCAGGAAAAGTAAACTGG - Intergenic
910046539 1:82924627-82924649 AGAGACCTAGAGAAGTAAGCTGG - Intergenic
910060178 1:83081523-83081545 ACAGAGCTGGAGAGGTAGGCAGG + Intergenic
911402738 1:97396816-97396838 TTAGACCTTGAGAAGTAGGTAGG - Intronic
912512453 1:110198485-110198507 CCAGGCCTGGACAAGTGGGCAGG - Exonic
912771430 1:112467233-112467255 CTAGATCAGGAGAAGTAAGCAGG + Intronic
913647537 1:120873276-120873298 TAACACCTGAAGAAGTAGGTGGG - Intergenic
914079102 1:144389584-144389606 TAACACCTGAAGAAGTAGGTGGG + Intergenic
914100077 1:144576918-144576940 TAACACCTGAAGAAGTAGGTGGG - Intergenic
914174006 1:145258131-145258153 TAACACCTGAAGAAGTAGGTGGG + Intergenic
914298912 1:146360764-146360786 TAACACCTGAAGAAGTAGGTGGG + Intergenic
914528667 1:148499316-148499338 TAACACCTGAAGAAGTAGGTGGG + Intergenic
914637726 1:149567792-149567814 TAACACCTGAAGAAGTAGGTGGG - Intergenic
915186549 1:154110580-154110602 AAAGAACTGGAAAAGTTGGCTGG + Intronic
915264666 1:154708202-154708224 GAAGACCTGGAGAAGCAGATTGG - Exonic
915472213 1:156132653-156132675 AAAGACCTGGAGAAGCCAGCAGG + Intronic
915594117 1:156886781-156886803 CAAGTGCTGGAGGAGCAGGCAGG - Intergenic
916475858 1:165168429-165168451 CAAGACTAAAAGAAGTAGGCAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917612231 1:176700258-176700280 CAATATCTGGAGCAGGAGGCTGG + Intronic
917629068 1:176875312-176875334 GAAGTGCTGGAGAAGTGGGCTGG + Intronic
919659653 1:200231335-200231357 CAAGACCTGGAGCAGCACCCAGG + Intergenic
920779861 1:208978748-208978770 AAAGGGCTGGAGAAGTAGGGAGG + Intergenic
924375747 1:243406681-243406703 CGAGACTTGGAGATGTAGGCAGG - Intronic
924597837 1:245462883-245462905 TAAGACCTGAAGAGGCAGGCAGG + Intronic
924608353 1:245554039-245554061 CCAGACCTGGAAAAGTAGGTGGG - Intronic
1062840525 10:666781-666803 GTAGGCCTGGGGAAGTAGGCAGG - Intronic
1064589250 10:16871926-16871948 CTAAACCTGCAGATGTAGGCTGG + Intronic
1067180526 10:43982479-43982501 CAGGCCCTGGAGGAGTAGGTTGG - Intergenic
1067938664 10:50633925-50633947 CCACACCTGGAGAACTAGGAAGG - Intergenic
1070374669 10:75818051-75818073 CAAGATCTGGAGAAGTGAGAGGG + Intronic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1070688234 10:78505662-78505684 AAAGGCCTGGAGAAGGAGACAGG + Intergenic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1071711820 10:88057345-88057367 AGAAAACTGGAGAAGTAGGCAGG + Intergenic
1073057428 10:100711353-100711375 CAAGAAATGGAGTAGGAGGCTGG - Intergenic
1077426650 11:2482970-2482992 TAAGACCTTGAGAAGGAGCCAGG + Intronic
1082828833 11:57600351-57600373 CAGGACCTGGGTAAGGAGGCTGG - Exonic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083993935 11:66262960-66262982 GAAGACCTGGAGAAGACGTCAGG + Exonic
1085541162 11:77271086-77271108 CCAGAGCTGAAGAAATAGGCAGG + Intronic
1088050091 11:105502567-105502589 GAAGAACTGAAGAAGTATGCAGG - Intergenic
1089322107 11:117633354-117633376 CAAGAGCTGGAGGGGTAGGGAGG + Intronic
1090748295 11:129724436-129724458 CAAGACCTGGGAAAGCAGGCAGG - Intergenic
1092837941 12:12509623-12509645 CAATAGCTGGAGAAGTAAGACGG - Intronic
1093166951 12:15815217-15815239 AAAGACCTGGGGAAGTTAGCTGG - Intronic
1094031253 12:26013531-26013553 TAACACCTGGAGTAGTAGCCAGG + Intronic
1096242799 12:49968247-49968269 CAAAACCTGGAAAGGTAGGGAGG - Intronic
1096809164 12:54158765-54158787 AAATAGCTGCAGAAGTAGGCTGG - Intergenic
1097640518 12:62175323-62175345 CAAGGCCCAGAGAAGTAGCCAGG - Intronic
1098177688 12:67809964-67809986 CCACACCTGTAGAAGTAAGCAGG + Intergenic
1098758140 12:74390435-74390457 CAAGTCCTGGAGACCTTGGCAGG + Intergenic
1099881508 12:88472535-88472557 CAAGTCCGTGAGAAGGAGGCAGG - Intergenic
1103303640 12:119947092-119947114 CAAAACCAGCAGAAATAGGCCGG - Intergenic
1103557428 12:121775045-121775067 CCAGAACTGGAGAGGAAGGCAGG - Exonic
1106272681 13:28169545-28169567 GAACACCTGGTGAAGTAGGTTGG + Intronic
1106757520 13:32837889-32837911 CAAGAGCTGGAGAGATACGCAGG + Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108806137 13:54158823-54158845 CAAGACATGGAGTGGCAGGCTGG + Intergenic
1112295098 13:98179520-98179542 TAAGAGCTGTAGAAGTGGGCTGG + Intronic
1112616784 13:101014644-101014666 CTAGACCTGGAGAGGCAAGCTGG - Intergenic
1113841467 13:113363914-113363936 CAAAACCGAGAGAAGGAGGCCGG + Intronic
1114776263 14:25485565-25485587 CAAAGCCTGGACAAGTCGGCTGG - Intergenic
1115163355 14:30420363-30420385 CAGGACCTCCAGAAGTAGGCAGG + Intergenic
1115916591 14:38321656-38321678 ACAGGCCTGGAGAAGTAGGAGGG - Intergenic
1117621990 14:57596949-57596971 CCAGACCTGGAGACGTATTCAGG + Intronic
1118117609 14:62798393-62798415 CAAGACATTGAGAAGTAACCTGG + Intronic
1118464398 14:66017546-66017568 TAAAAGCTGGAGAAGTAAGCAGG - Intergenic
1119745176 14:77038701-77038723 GAAGACCTAGAGAAGAAGGAAGG - Intergenic
1120032333 14:79656302-79656324 CAAGACCTGGAGCAGTCTCCTGG - Intronic
1120086477 14:80280552-80280574 CATGGGCTGGAAAAGTAGGCTGG + Intronic
1120680135 14:87471291-87471313 CAAGAGCTGGAGTTGCAGGCGGG + Intergenic
1121329485 14:93040932-93040954 CGACACCTCGAGATGTAGGCAGG - Intronic
1121826600 14:97015348-97015370 CAAAACCACCAGAAGTAGGCAGG - Intergenic
1125427821 15:39567336-39567358 AAAGATCTGGAGAAGTCGGCCGG - Intergenic
1125463643 15:39929744-39929766 CAAGACCAGGAGATGTAGTTTGG + Intergenic
1126265814 15:46752733-46752755 CAAGGCATGTAGAAGTAGTCAGG + Intergenic
1126544433 15:49857301-49857323 CAAGGCCTGGAGAAGTCAGGTGG + Intergenic
1128055703 15:64698652-64698674 CAAGAAAGGGACAAGTAGGCAGG - Intronic
1129677675 15:77641242-77641264 CATCAGCTGGAGAAGAAGGCAGG - Intronic
1130415080 15:83686007-83686029 CCAGACCAGGAGAAGGAGGAGGG - Intronic
1131425265 15:92340742-92340764 CAAAACCTCCAGAGGTAGGCTGG - Intergenic
1132233536 15:100202029-100202051 CACGCCCTGGAGAAGTTGCCTGG + Intronic
1132269775 15:100513423-100513445 GAAGAACTGGAAAAGTAGGCAGG - Intronic
1132461791 16:59059-59081 CGGGACCTGGAGAAGCTGGCAGG - Exonic
1134500696 16:14767199-14767221 CAAGACCCAGAGAGGGAGGCAGG - Intronic
1134714822 16:16352348-16352370 CAAGACCCAGAGAGGGAGGCAGG - Intergenic
1134722699 16:16395710-16395732 CAAGACCCAGAGAGGGAGGCAGG - Intergenic
1134951993 16:18356311-18356333 CAAGACCCAGAGAGGGAGGCAGG + Intergenic
1135229639 16:20693715-20693737 CAATAAGTGGAGAAGCAGGCAGG - Intronic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1137755608 16:50899712-50899734 CAAGACCTGGAGAAGGTGGGAGG - Intergenic
1139718713 16:68835613-68835635 CAAAACGTGGAGAAAGAGGCCGG + Intergenic
1141226547 16:82121632-82121654 AATGATCTGGAGAATTAGGCAGG + Intergenic
1143996844 17:11013822-11013844 TAAGACCTGCAGAAGTACGTTGG - Intergenic
1144729375 17:17517843-17517865 CAAGGCCTGGAGGAGTGAGCCGG - Intronic
1145009550 17:19360052-19360074 CAACACCTGCAGTAGGAGGCAGG - Intronic
1145081375 17:19897293-19897315 GAAGACTTGGAGAAACAGGCAGG + Intergenic
1146301416 17:31692579-31692601 CTAGAACTAGAGAAGAAGGCTGG + Intergenic
1147636089 17:41965236-41965258 CAAGATCAGGAGAAACAGGCAGG + Exonic
1148891870 17:50813432-50813454 ACGGAGCTGGAGAAGTAGGCAGG + Intergenic
1148943956 17:51241860-51241882 TAAAACCTTGAAAAGTAGGCTGG - Intronic
1149347148 17:55750806-55750828 GAAGAGCTGGAGAAGTAAGGAGG - Intergenic
1150502604 17:65665431-65665453 AGAGACCTAGAGCAGTAGGCAGG - Intronic
1150739680 17:67769345-67769367 CCAGAGCAGGAGCAGTAGGCAGG - Intergenic
1150965087 17:69959098-69959120 CAAGACCTGAAGTAGTATCCTGG - Intergenic
1151557475 17:74853968-74853990 AAAAGCCTGGAGAAGGAGGCGGG - Intronic
1151599063 17:75095129-75095151 CAGGACCTGGAATAATAGGCAGG - Intronic
1152863005 17:82706625-82706647 GAAGACCTGGAGATGGAGGGTGG - Intergenic
1156491542 18:37499359-37499381 CAAGACCTGGGAATGTGGGCTGG + Intronic
1157287690 18:46388296-46388318 GCAAACCTGGAGAAGTTGGCAGG + Intronic
1159591069 18:70335907-70335929 CACGACCTTGTGAAGGAGGCAGG - Intronic
1164015876 19:21255671-21255693 CAAGACTGGGAGAAGAAAGCTGG + Intronic
1166918256 19:46210894-46210916 AAAGTCCTGAAGAAGTTGGCTGG - Intergenic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
927388715 2:22568188-22568210 CAAGATCTGGTCAAGTAGGGGGG + Intergenic
927695481 2:25236830-25236852 CACTAGCTGGAGAAGCAGGCGGG + Intronic
927707153 2:25303494-25303516 CAGGACCTGGAGAGGTGGCCTGG - Intronic
927840205 2:26436788-26436810 CAAGGCCAGGAGAAGAAGGAGGG + Intronic
931140624 2:59453660-59453682 CCAGACCGGGAGAAGGAGGAAGG - Intergenic
931754659 2:65362219-65362241 CAAGTGCTGCAGAAGCAGGCTGG - Intronic
931754776 2:65362958-65362980 CAAGTGCTGCAGAAGCAGGCTGG - Intronic
932421134 2:71602112-71602134 CAAGACCTCCAGAAGAAGGAAGG - Intronic
932627503 2:73309225-73309247 CAAGGCCTGGAGAAAAAGCCAGG - Intergenic
934760398 2:96852526-96852548 AAAAACCTGGAGAAGGGGGCAGG + Intronic
935465160 2:103388289-103388311 AATGAGCTGGAGAAGCAGGCAGG - Intergenic
936275600 2:111094167-111094189 GAAAACCTGGAGAAGTCGTCAGG + Intronic
937002453 2:118479875-118479897 AAAAACTTTGAGAAGTAGGCAGG - Intergenic
938108497 2:128549197-128549219 CAATGCCTGGAGAAGTAATCAGG - Intergenic
938236174 2:129708793-129708815 CAAAAGCTCCAGAAGTAGGCTGG + Intergenic
938978422 2:136502291-136502313 CAAGACCTGCAGCAGCAAGCTGG + Intergenic
940562330 2:155314148-155314170 AATGATCTGGAGAATTAGGCAGG - Intergenic
940828769 2:158443804-158443826 CAAGACTTGAGGAAGCAGGCAGG + Intronic
941942330 2:171053783-171053805 CAGGACCTGGAAAAGAAGGAGGG - Exonic
944464033 2:199982620-199982642 CAAGGCCTGGATAAGCAAGCAGG - Intronic
945853307 2:215035803-215035825 CAAAAGCTGGAGAAGTAAGCAGG - Intronic
946158041 2:217819869-217819891 CAAAACCTGGAGCTGCAGGCTGG + Intronic
946389071 2:219404771-219404793 GAAGACCAGGAGAAGCAGCCTGG + Intergenic
946445620 2:219737635-219737657 CATGCCCTGCAGAAGTTGGCTGG + Intergenic
947940902 2:234054197-234054219 AAAGACCTTGAGAGGGAGGCTGG + Intronic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
1168741977 20:199900-199922 CAGGGCCTTGAGAAGTAGCCAGG - Intergenic
1168766925 20:388163-388185 CACGATCTGGAGCAGTAGGTGGG - Exonic
1172610688 20:36249618-36249640 CAAGAGGTGTAGGAGTAGGCAGG - Intronic
1172749632 20:37241712-37241734 AAAGGCCTGGAGAAATATGCTGG - Intergenic
1172924632 20:38521682-38521704 CAAGACCTGGATAAATAAGCTGG - Exonic
1173072012 20:39777231-39777253 GCAGACCTGGAGATGTAGACAGG + Intergenic
1173216452 20:41089320-41089342 CAAGAACTGGGGGAATAGGCTGG - Intronic
1175878395 20:62242221-62242243 CAAGAGCTGCAGAGGTGGGCCGG - Intronic
1176123277 20:63463790-63463812 GAAGACCTGGAGGATGAGGCGGG + Intronic
1176666238 21:9689990-9690012 CAAGATCTGTAGAAGTTGGTTGG - Intergenic
1177576491 21:22963352-22963374 TAAGACTTGGCGATGTAGGCCGG + Intergenic
1177856221 21:26403642-26403664 CAAGAGGTGGAAAAGTAGGTAGG - Intergenic
1178460676 21:32799441-32799463 CAGGACTTGGAGAGGTAAGCAGG - Intronic
1178489622 21:33041027-33041049 CATGAGCTGGAGAAGCAGGCAGG - Intergenic
1178601028 21:33994208-33994230 GAAGACCTGGATAAGGAGGAAGG - Intergenic
1179034433 21:37747442-37747464 TAAGACCTGCAGAAGTGAGCTGG + Intronic
1179723317 21:43328314-43328336 CAATCCCTGGAGAAGGGGGCTGG + Intergenic
1179879461 21:44287333-44287355 CCGGAGCTGGTGAAGTAGGCGGG + Intronic
1181366011 22:22377574-22377596 CCAGATCAGGAGAAGCAGGCTGG - Intergenic
1183792855 22:40087808-40087830 GAGGAGCTGGAGATGTAGGCAGG + Intronic
1184799523 22:46751288-46751310 GAAGAGCTGGAGAAGGAGGGAGG - Intergenic
949607480 3:5670192-5670214 CAAAATTTGGTGAAGTAGGCTGG + Intergenic
949708489 3:6846237-6846259 CAAGATCAGGAGAAGTAAGATGG + Intronic
950645155 3:14372695-14372717 TCAGACCTGGGGAAGTAGGGTGG + Intergenic
950679181 3:14573354-14573376 CGGGACCTGGAGAAGCTGGCAGG - Intergenic
951855173 3:27187909-27187931 AAAAGCCTGGGGAAGTAGGCTGG - Intronic
952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG + Exonic
953532641 3:43752394-43752416 CAACACCTGGAGAAGGACGTGGG + Intergenic
954197501 3:49005339-49005361 CAACACCTGGAGGAATGGGCAGG - Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954536351 3:51362088-51362110 CAGGAGCTAGAGAATTAGGCAGG - Intronic
956051154 3:65249874-65249896 CAAGAGGTGGAGAAGGATGCTGG - Intergenic
956692938 3:71894309-71894331 CAAGACCTGGATGAGTAAACAGG + Intergenic
957808965 3:85192510-85192532 CAAGAAGTGGAGAAGTAGGAAGG + Intronic
957927185 3:86829209-86829231 CAGGACCTGGGGAAGTAGAAAGG - Intergenic
959702725 3:109313276-109313298 CATGAGCTGGAGAGGCAGGCAGG - Intronic
960407570 3:117280765-117280787 AAAGACCTGGAGAACTTGGTTGG - Intergenic
961520508 3:127464966-127464988 CAAGAGCTGGCCAAGTGGGCTGG + Intergenic
962526339 3:136241168-136241190 CAAAATCTGAAGAAGTGGGCTGG + Intergenic
963767863 3:149356452-149356474 CAAGTCATGGAGATGGAGGCAGG + Intergenic
965443179 3:168742031-168742053 AAAGACCTTCAGAAGTAGGTGGG + Intergenic
966676912 3:182599565-182599587 GAAGGCCTGGAGAAGGAGACTGG - Intergenic
966979464 3:185117752-185117774 GACAAGCTGGAGAAGTAGGCAGG - Intronic
967059498 3:185859508-185859530 TAAGACCTGGAGAATGAGGAAGG - Intergenic
968574772 4:1360493-1360515 CCAGGCCTGGACAAGGAGGCCGG - Intronic
969091635 4:4698290-4698312 AAAGAGCTGGGGAAGTGGGCAGG + Intergenic
970059380 4:12013792-12013814 CATGACTTGGAGAAGTATGAAGG - Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970523369 4:16907929-16907951 CAAGTCCTGGAGATGTAGTTTGG - Intergenic
972305532 4:37826646-37826668 CAAGACGTGGAGGCGGAGGCGGG - Exonic
974517270 4:62934105-62934127 CTGGAGCTGGAGAAGTAGGTAGG - Intergenic
975562768 4:75723200-75723222 CAGGAGCTGAAAAAGTAGGCAGG + Intronic
977996762 4:103504376-103504398 CAAGCCCTGGTGAAGTAGACAGG - Intergenic
978275379 4:106942938-106942960 CAAGACCTGGAGAAGTAGGCAGG - Intronic
978740934 4:112137165-112137187 CAGGATCTGGAGAAGTAAGGTGG - Intergenic
982474054 4:155828426-155828448 CAATATTTGGATAAGTAGGCCGG + Intergenic
984180586 4:176478140-176478162 GGAGACCTGGAGAAGTAGATGGG + Intergenic
985408783 4:189662346-189662368 CAAGATCTGTAGAAGTTGGTTGG + Intergenic
989474487 5:41858178-41858200 CAAGACCTGAAGAACTGGTCAGG - Intronic
990044663 5:51414566-51414588 CAAGAGCTGGGGAAGTGGGCAGG - Intergenic
992228183 5:74639503-74639525 CAAAACCTGGAGAAGGGTGCGGG - Intronic
992749397 5:79848544-79848566 CAAGACCAGAGGAAGTTGGCAGG + Intergenic
992829994 5:80584785-80584807 AGAGACTTGGAGAAGGAGGCAGG - Intergenic
995470419 5:112496058-112496080 CAAGAGGTCCAGAAGTAGGCAGG + Intergenic
995918751 5:117284469-117284491 GAAGAACAGGAGAAGCAGGCCGG - Intergenic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996951820 5:129135921-129135943 CAAGACATGGAGAAGTAGAAAGG - Intergenic
997399465 5:133591271-133591293 CAAGACAGGGAGAGGAAGGCAGG + Intronic
999230210 5:150057366-150057388 CTAGACCTGGACAAGGAGGATGG - Exonic
999384630 5:151145472-151145494 AAAGACATGAAGAAGTAGGATGG - Intronic
999571760 5:152926645-152926667 CAAGACCAGGAGAGGTGGGAAGG - Intergenic
1000121949 5:158205956-158205978 GAAGAACTGGTGAAGTAGTCAGG + Intergenic
1000866026 5:166515816-166515838 AAGGAACTGAAGAAGTAGGCTGG + Intergenic
1002163349 5:177330214-177330236 CCAGAACTGGAGAAGAAGGCAGG + Intergenic
1005907027 6:30271153-30271175 CAAAACTTGGAGAAGAAAGCAGG + Intergenic
1006101055 6:31686683-31686705 GAAGAACTGAAGAAGGAGGCGGG + Intergenic
1006727275 6:36208745-36208767 CTGGTCCTGGGGAAGTAGGCAGG + Intronic
1007515263 6:42405857-42405879 CAAGACAGAGAGAAGCAGGCAGG + Intronic
1007538456 6:42618305-42618327 GAAAACCTGGAGGAGTAGGGTGG + Intronic
1007829864 6:44629907-44629929 CAAGACCTGTAGAAGGAGGGAGG - Intergenic
1008211936 6:48736095-48736117 CAAGAGTTGAAGAAGCAGGCAGG + Intergenic
1009057927 6:58360643-58360665 CAACACCTGGCAAAATAGGCTGG - Intergenic
1009232902 6:61086448-61086470 CAACACCTGGCAAAATAGGCTGG + Intergenic
1011500140 6:87979234-87979256 AAAGAAGTGGAGAAGTAGGGAGG + Intergenic
1013916903 6:115351221-115351243 CAAGAACTGGAGGAGTAGCAAGG + Intergenic
1014789883 6:125660165-125660187 CAATACATGAAGAAGTAGGAGGG - Intergenic
1019613126 7:1946938-1946960 CAAGTCCTGGAGGAGGAGGCTGG + Intronic
1020778001 7:12480313-12480335 AAAGACCAGAAGAAGTAGTCAGG + Intergenic
1022027257 7:26460108-26460130 CAAGACCTGGAAAGGTAAGCTGG - Intergenic
1022479265 7:30732620-30732642 CAAGAGCTGGAGAAGTACATGGG - Intronic
1022858475 7:34340514-34340536 GAAGACATGGACAAGTAAGCAGG - Intergenic
1024212103 7:47215261-47215283 CAAGATCTGGGGCAGGAGGCTGG - Intergenic
1026329017 7:69336063-69336085 CAAGAACAGGTGAAGTAGGATGG - Intergenic
1027727195 7:81822440-81822462 CAAGACCTGGGAAAATAGTCTGG - Intergenic
1031927193 7:127650239-127650261 GAAGACCTGGAGGAAAAGGCAGG + Intergenic
1034413857 7:150955036-150955058 CAGGACCAGGAGAAGCCGGCAGG - Intronic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1036732220 8:11275885-11275907 TACGACCTGGTGAAGTAGACAGG - Intergenic
1037406168 8:18544967-18544989 CAAGACCAGGAGTAGAAAGCAGG + Intronic
1040049246 8:42996030-42996052 CAAGACCTTGGGAGGTAAGCTGG + Intronic
1040377282 8:46838568-46838590 GATGATCTGGAGAATTAGGCAGG + Intergenic
1041710724 8:60891959-60891981 CAAGATCTTGAAAACTAGGCTGG + Intergenic
1043256039 8:78137830-78137852 TAAGACCTGGAAAACTATGCTGG - Intergenic
1044387942 8:91612103-91612125 GATGAGCTGGAGAAGTAGGCTGG + Intergenic
1048077985 8:131094190-131094212 CAGGACCTGGGAAAGTAGCCTGG + Intergenic
1049258210 8:141625066-141625088 GAAGCCCTGGAGGAGGAGGCAGG - Intergenic
1050195943 9:3084902-3084924 CCAGATCTGGAGAAGAGGGCAGG + Intergenic
1052355274 9:27498100-27498122 CAAGGCCTGGAGAAGGGGGTGGG - Intronic
1053092540 9:35292314-35292336 AAAAACCTGCAAAAGTAGGCTGG - Intronic
1053163325 9:35828672-35828694 CATGACCTGGGGAAGTGGGTAGG + Exonic
1057104924 9:92405674-92405696 CAAGATATTGAGAAGTAAGCTGG + Intronic
1058448379 9:105073794-105073816 AATGACCTGGAAAAGTATGCAGG + Intergenic
1059658967 9:116382526-116382548 CACAAGCTGGAGAAGTGGGCAGG - Intronic
1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG + Intronic
1060332613 9:122686800-122686822 CAGGACCTGGAAAAGAAGGAAGG + Intergenic
1061677139 9:132223883-132223905 CCAGACCAGGAGACGGAGGCGGG - Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1062086292 9:134650662-134650684 CTGGCCCTGGAGAAGCAGGCTGG - Intronic
1062569768 9:137179695-137179717 ACAGACCTGGAGAAGGGGGCAGG + Intronic
1203659861 Un_KI270753v1:31771-31793 CAAGATCTGTAGAAGTTGGTTGG + Intergenic
1185798591 X:2988246-2988268 CAACACCTTGAGAAACAGGCAGG - Intergenic
1186223427 X:7373796-7373818 GAAGACTTGGAGAAGTATGAGGG - Intergenic
1186386596 X:9116283-9116305 CAGGAATTGGAGGAGTAGGCTGG - Intronic
1187768093 X:22665252-22665274 GAAGAGCTAGAGAAGCAGGCAGG - Intergenic
1191939419 X:66462337-66462359 CAAAAGCTGGAGAAATAGACAGG - Intergenic
1194488869 X:94522067-94522089 CAACGACTGGAAAAGTAGGCAGG - Intergenic
1195997528 X:110746086-110746108 AAAGCCCTGGAGAAGTTGGTGGG + Intronic
1196431154 X:115627146-115627168 CTAGAACTAGAAAAGTAGGCTGG - Intronic
1196576482 X:117324955-117324977 TAAGACTTGTAGATGTAGGCTGG + Intergenic
1198301162 X:135335207-135335229 GTAGACTGGGAGAAGTAGGCAGG + Intronic
1200115133 X:153766642-153766664 CAAGAGCTGGAGCAAGAGGCAGG - Intronic
1201592975 Y:15636062-15636084 GAAGACTTGGAGAAGTATGAGGG - Intergenic