ID: 978275978

View in Genome Browser
Species Human (GRCh38)
Location 4:106950445-106950467
Sequence CCTTTTCCACAGGTGCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978275978_978275982 20 Left 978275978 4:106950445-106950467 CCCTACTGCACCTGTGGAAAAGG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 978275982 4:106950488-106950510 ACTTGCTGAAAACTATCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978275978 Original CRISPR CCTTTTCCACAGGTGCAGTA GGG (reversed) Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
903768267 1:25748526-25748548 CCATTTCCTCAGCTGCAGAAGGG - Intronic
912128128 1:106565910-106565932 CTTTTTCCACAGGTCCAAGAAGG - Intergenic
912368872 1:109157431-109157453 CCTTTTCCCCATGTGCGATAGGG - Intronic
914711662 1:150220362-150220384 ACTTTTACACAGGTGTAGTATGG - Exonic
915512676 1:156394975-156394997 CCTATCCCCCAGCTGCAGTAGGG + Intergenic
918685357 1:187408322-187408344 CCCTTGACACATGTGCAGTAAGG - Intergenic
920174352 1:204090844-204090866 CCTTTGCACCAGGTGCTGTAAGG + Intronic
921179106 1:212617582-212617604 CCTTTTCTACAGGAGCATCATGG + Intronic
922643602 1:227261905-227261927 TCTTTACCACATGGGCAGTATGG - Intronic
1063881333 10:10535782-10535804 CCTTATCCACAGGAGCAGAATGG + Intergenic
1070572447 10:77650334-77650356 CTCTTCCCAAAGGTGCAGTATGG - Intergenic
1072836295 10:98717277-98717299 CCTTCTCCATAGCTGCAATAAGG + Intronic
1073210604 10:101798775-101798797 CCTTTTCCACATTACCAGTATGG + Intronic
1074956440 10:118395536-118395558 ACTTTTCAACAGCTGCACTAAGG + Intergenic
1075523583 10:123162402-123162424 CATTTGCCACAGGTAAAGTATGG + Exonic
1075625693 10:123963062-123963084 CCTCTGCCCCAGGAGCAGTATGG + Intergenic
1077586171 11:3455110-3455132 CCGTCTCCAGAGGTTCAGTATGG - Intergenic
1079495453 11:21038219-21038241 CCTTTTGTACAGTTGCAATAAGG - Intronic
1083663932 11:64264744-64264766 CCTTTTCCACATGGGCTGTGGGG - Intronic
1086840020 11:91673453-91673475 CCTTTTCTACAGGTATAGAAAGG - Intergenic
1087065476 11:94024023-94024045 CCATTTCCCCAGGAGCAGGAAGG + Intronic
1089320226 11:117620845-117620867 CAGTTTCCACAGGTGCAAAATGG + Intronic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1089730479 11:120515938-120515960 CCTTTTCCACAGATGAGGAAGGG + Intronic
1092505073 12:9090397-9090419 CCGTTTGCACAGATGCAGTGAGG + Exonic
1092883755 12:12908231-12908253 CCTTTTCTGCAGGTCCAGAATGG + Exonic
1097601613 12:61699592-61699614 CCCTTAACACATGTGCAGTAAGG + Intergenic
1098228316 12:68347401-68347423 GCTTTTCCAGGTGTGCAGTAGGG - Intergenic
1100984069 12:100188306-100188328 CCTCTGCCACAGGTGCCGTAGGG - Intergenic
1102662559 12:114542466-114542488 CCATTTTCACAGGTGCAAAATGG + Intergenic
1104760807 12:131296702-131296724 CCCTTCCCACAGCTGCAGTGAGG - Intergenic
1104818968 12:131664090-131664112 CCCTTCCCACAGCTGCAGTGAGG + Intergenic
1106322114 13:28650485-28650507 CCATTCCTACAGATGCAGTAAGG - Intergenic
1108474345 13:50798893-50798915 CCTTTTCTGCAGGTGGAGTGAGG - Intronic
1109001618 13:56812153-56812175 CCATTACCACAGGTACAGTGGGG + Intergenic
1112375402 13:98835579-98835601 CCTTTGCCACAGGACCAGTGAGG + Intronic
1113139092 13:107127339-107127361 CCTTATCCACAGAGGCAGTGTGG - Intergenic
1113451903 13:110416309-110416331 CCCTTTCCTCAGGTGCAGTCTGG + Intronic
1113600344 13:111563864-111563886 CCTTGACCACAGGTGAAGTCAGG - Intergenic
1114406804 14:22464363-22464385 CCCTTTCCCCATGTGCAGCATGG - Intergenic
1116369223 14:44108765-44108787 CCTTTAACACATGTGCAGCAAGG + Intergenic
1116514115 14:45785547-45785569 CCCCTAACACAGGTGCAGTAAGG + Intergenic
1117752565 14:58939049-58939071 CCTGCTCCACAGGAGCAGGATGG - Intergenic
1120905923 14:89621230-89621252 ACTTTACCATAGGTGCAGGAGGG - Intergenic
1121535099 14:94685799-94685821 CCTTTGCTAGGGGTGCAGTATGG - Intergenic
1125928556 15:43583443-43583465 AGTTTTCCACAGGTTCATTAAGG + Exonic
1125941722 15:43683278-43683300 AGTTTTCCACAGGTTCATTAAGG + Intergenic
1130028430 15:80290114-80290136 CTTTGTCCACAGGTGCTGTCAGG + Intergenic
1131638196 15:94260187-94260209 CCTGTTCCTCAGGGGCAATAAGG + Intronic
1136932216 16:34429235-34429257 CCTTTTCCACCTCTGCAGTTGGG - Intergenic
1136972356 16:34982579-34982601 CCTTTTCCACCTCTGCAGTTGGG + Intergenic
1138365141 16:56469524-56469546 GCTTTACCACAGGAGGAGTAGGG + Intronic
1143537199 17:7548736-7548758 CCTTTCCCCCAGGTGCAGGGAGG - Intergenic
1144334011 17:14253028-14253050 CCCTTAACACATGTGCAGTAAGG + Intergenic
1144713287 17:17417181-17417203 CCTACTCCCCAGGTGCAGGAAGG + Intergenic
1145289398 17:21531190-21531212 CCTTTTCTAAATGTGAAGTATGG - Exonic
1147051701 17:37800018-37800040 CCATTGCCTCAGGTGGAGTAGGG + Intergenic
1151436743 17:74102436-74102458 CCTTTTCCTCAGGTCCACTCGGG + Intergenic
1152822730 17:82445472-82445494 ACTTGTCCGCAGGTGCAGTCTGG - Intronic
1154026965 18:10717005-10717027 CTTTAACCACAGGGGCAGTAGGG + Intronic
1155228288 18:23749519-23749541 CATTTTCCAAAGGTACAATACGG - Exonic
1157651012 18:49331078-49331100 ACATTTCCACAGCTGCATTATGG - Intronic
1157807458 18:50668621-50668643 CCCTTTCAACAGGGGCAGTCTGG + Intronic
1160604384 18:80038331-80038353 CCATGTCCCCAGGTGAAGTAGGG - Intronic
1161650000 19:5478465-5478487 CCTCTTCCACAGGCGCCGCAGGG - Intergenic
1165035763 19:33032403-33032425 CCTTCTCCAGAGGTGGTGTAGGG + Intronic
1166978908 19:46621414-46621436 CCTTTCCCACAGGAGCAGAGGGG + Exonic
1167508439 19:49883185-49883207 CGTATTCCACAGGCGCAGGATGG - Intronic
926762998 2:16296028-16296050 TTTTTTCCAAAGGTGCAGTGTGG - Intergenic
929863993 2:45702359-45702381 CCCATTTCACAGGTGCAGAAAGG - Intronic
931214325 2:60227191-60227213 CCTCTGACACATGTGCAGTAAGG - Intergenic
933978689 2:87532812-87532834 CCTTTTCTACAGGGGCTGAATGG - Intergenic
935905073 2:107830233-107830255 CCTTTTCCACAGATGTTTTAAGG + Intronic
936126854 2:109795317-109795339 CCTTTTCCACAGATGTTTTAAGG + Intronic
936217843 2:110576169-110576191 CCTTTTCCACAGATGTTTTAAGG - Intronic
936315143 2:111417983-111418005 CCTTTTCTACAGGGGCTGAATGG + Intergenic
940508004 2:154580208-154580230 CCTTATCCACTGCTGCAGAAGGG + Intergenic
941264120 2:163338370-163338392 TCCTTTCCACAAGTGCAGCAAGG + Intergenic
944274283 2:197818361-197818383 CCTTTTCCCCAGGCTGAGTAAGG + Intronic
945742473 2:213680280-213680302 CCTTATCCACAGGAGCATAATGG + Intronic
946695102 2:222348820-222348842 CCTTTTCCAGAGCAGCAGTTTGG + Intergenic
948800915 2:240433169-240433191 GCTCTTCCACAGGTGCAGTGAGG - Intergenic
948856790 2:240733995-240734017 CCTTTTCCCCGGCTGCAGTGAGG - Intronic
1173274339 20:41566508-41566530 CCTTATCCACAGGAGCAGAGTGG - Intronic
1174959929 20:55144495-55144517 CCCTTGACACAGGTGCATTATGG - Intergenic
1175248647 20:57596199-57596221 CCGTTTCCACATGTGCAAAATGG - Intergenic
1177160255 21:17539590-17539612 CCTGTTCCACAGGTTTTGTAAGG + Intronic
1177571346 21:22890803-22890825 CCCTTAACACATGTGCAGTAAGG - Intergenic
1180162644 21:46005247-46005269 CTCTGTCCACAGGTGCAGCATGG - Intergenic
1180613899 22:17115079-17115101 ACTTTGTGACAGGTGCAGTAGGG - Exonic
1182115066 22:27751741-27751763 CCCTTTCCAGAGGAGCAGGAAGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184100151 22:42337833-42337855 CCTCTTCCACAGCTGCATTTAGG - Intronic
950554650 3:13688101-13688123 CCTATTCCACAGATGAAGAAGGG + Intergenic
952098976 3:29989393-29989415 CCTGATGCACAGGTGCATTATGG + Intronic
952408385 3:33025914-33025936 CCCTTTCCACAGCAGCAGCAAGG - Intronic
953437045 3:42885870-42885892 CCCTTAACACATGTGCAGTAAGG - Intronic
956134326 3:66084007-66084029 CATTTTCTAGTGGTGCAGTAAGG + Intergenic
957069160 3:75552207-75552229 CCGTCTCCAGAGGTTCAGTATGG + Intergenic
957307948 3:78481935-78481957 CCTTTTCCTCAGGCTCTGTAAGG + Intergenic
959634546 3:108549410-108549432 CCTTCTTCAAAGCTGCAGTACGG + Intergenic
960399515 3:117179246-117179268 CTGTTTCCACAGCTGCAGAATGG + Intergenic
961882441 3:130071646-130071668 GCTTATCCACAGATGCAGGACGG + Intergenic
967344323 3:188436948-188436970 CAGTTTTCAGAGGTGCAGTAGGG + Intronic
969001358 4:3985065-3985087 CCGTCTCCAGAGGTTCAGTATGG - Intergenic
969050844 4:4371816-4371838 CCTTTTCCACAGGAGAACAATGG + Intronic
969752654 4:9123634-9123656 CCGTCTCCAGAGGTTCAGTATGG + Intergenic
969812560 4:9659797-9659819 CCGTCTCCAGAGGTTCAGTATGG + Intergenic
973128193 4:46615212-46615234 CCTTTTCCACATCAGCAATAAGG - Intergenic
978275978 4:106950445-106950467 CCTTTTCCACAGGTGCAGTAGGG - Intronic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
982630427 4:157823701-157823723 CCTTTTCCACTTCTGCAGTTTGG - Intergenic
982775232 4:159434822-159434844 CCTGTTCCACAGGAGAAGCAGGG + Intergenic
983187838 4:164720999-164721021 CCCTTAACACATGTGCAGTAAGG + Intergenic
983670605 4:170233087-170233109 CCTGTTCCACAGGTGAAGGTGGG - Intergenic
989289209 5:39742632-39742654 CCTTTGCCAGATGTGCAGAAAGG + Intergenic
989373471 5:40734338-40734360 CCTATCCAACAGCTGCAGTAGGG - Intronic
991474193 5:67002737-67002759 CATTTTCCCCAGCTGCAATATGG - Intronic
993121533 5:83780269-83780291 CCTTTTCTCCAGGTACAGGAAGG + Intergenic
993598094 5:89884763-89884785 CCTTCTCCACAGAAGCAGCATGG + Intergenic
997259751 5:132456798-132456820 CCTTTTCCTCCTGTCCAGTAGGG - Intronic
997490749 5:134273822-134273844 CCATCTCCACATTTGCAGTAAGG - Intergenic
1000150141 5:158492200-158492222 CCTATTCCACATCTGCATTATGG - Intergenic
1004321730 6:14636629-14636651 CCCTTTACAAAGGTGCAGTGTGG - Intergenic
1005567756 6:27113766-27113788 CCTTTTCTTCAAGAGCAGTAGGG + Intergenic
1006749247 6:36366385-36366407 CCTCTCCCAGGGGTGCAGTAGGG + Exonic
1010988009 6:82448354-82448376 CCTTTTCCCCAGGTGCCTTCTGG - Intergenic
1010991364 6:82484218-82484240 CCTTTAACACATGCGCAGTAAGG + Intergenic
1010992041 6:82490193-82490215 CCCTTAACACACGTGCAGTAAGG + Intergenic
1012453176 6:99375317-99375339 ATTTTTCCACTGGTGCAGTCGGG - Intronic
1015753148 6:136581552-136581574 CCATCTCCCCAGCTGCAGTAGGG - Intronic
1018115061 6:160574715-160574737 CCTTTTCCACTTCTGCAGTTGGG + Intronic
1018360636 6:163063817-163063839 CCTCATCCACAGCTGCAGGAAGG + Intronic
1019830081 7:3319262-3319284 CCTTTTCCACAGGAGAGGGATGG + Intronic
1021243802 7:18237084-18237106 CTTTTTCCACTGGTGCAGGTTGG + Intronic
1022112504 7:27240165-27240187 CCCTTTCCACCGGCGCATTAGGG - Intergenic
1023971005 7:44990945-44990967 CCCTTAACACATGTGCAGTAAGG - Intergenic
1024743673 7:52382994-52383016 CCCTTAACACATGTGCAGTAAGG - Intergenic
1024745484 7:52400590-52400612 CCTTTTCCACTTCTGCAGTTGGG + Intergenic
1027294189 7:76750213-76750235 CCTTTTCCATATCAGCAGTAAGG - Intergenic
1027877259 7:83787032-83787054 CCTTATCCACAGGAGCAGAGTGG - Intergenic
1033886997 7:145961275-145961297 CCTTGTCCACAGGTGAGGGAGGG + Intergenic
1036375871 8:8199028-8199050 CCGTCTCCAGAGGTTCAGTATGG + Intergenic
1036853657 8:12224115-12224137 CCGTCTCCAGAGGTTCAGTATGG - Intergenic
1036875033 8:12466625-12466647 CCGTCTCCAGAGGTTCAGTATGG - Intergenic
1046285864 8:112092353-112092375 CCATTGCCACTGCTGCAGTAAGG - Intergenic
1049443782 8:142620852-142620874 CCTTGTCCACAGGGGCAGAGTGG + Intergenic
1060344833 9:122806955-122806977 CCTTTTTCACCGATGCAGTCTGG + Intronic
1190048096 X:47128650-47128672 CTTTTTTCACAGGTGCAGTGAGG + Intergenic
1196007711 X:110853533-110853555 CCTTATCCAGAGGTGCTCTAAGG - Intergenic
1196282682 X:113841218-113841240 CCTAATCCACAGGTGCAATATGG - Intergenic
1197509056 X:127348122-127348144 TCTTTTCCAAAGATGCAATATGG - Intergenic
1198463556 X:136884925-136884947 CCTTTTTAAGAGGTGGAGTAAGG + Intergenic