ID: 978279029

View in Genome Browser
Species Human (GRCh38)
Location 4:106987542-106987564
Sequence CTGCCTGAGGAAAGGGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978279021_978279029 -5 Left 978279021 4:106987524-106987546 CCTGCTTTCTCCTCTCCCCTGCC 0: 1
1: 0
2: 19
3: 192
4: 1570
Right 978279029 4:106987542-106987564 CTGCCTGAGGAAAGGGACGCAGG 0: 1
1: 0
2: 0
3: 18
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978279029 Original CRISPR CTGCCTGAGGAAAGGGACGC AGG Intronic
902702456 1:18181773-18181795 CTGCCTGGGCCAAGGGACCCTGG - Intronic
903279716 1:22243679-22243701 CTGCCTGCAGGGAGGGACGCTGG + Intergenic
903935141 1:26890206-26890228 CCGCCTGAGGCGAGTGACGCTGG - Exonic
904283266 1:29436422-29436444 CTGCCAGGGAAAAGGGAAGCAGG + Intergenic
904896693 1:33823161-33823183 CTGGCTGAGGAAAGGGGAGGCGG - Intronic
904936434 1:34132800-34132822 AGGCCTGAGGAAAGGGATGTGGG - Intronic
906048409 1:42850995-42851017 CTGCCTGAGGAAGGGGAAGGGGG + Exonic
907413004 1:54295453-54295475 ATGCCTCATGAAAGGGACACGGG - Intronic
907973426 1:59407360-59407382 CCGCCTGAGAAAAGGGAGGAGGG + Intronic
910175816 1:84429181-84429203 CTGGCTTAAGAAAGGGACACAGG - Intergenic
911038364 1:93572873-93572895 CTCCCTGAGCAAAGGGCAGCAGG + Intronic
913045326 1:115069115-115069137 CTGCCTTAGGAAAGGGAGATGGG + Intronic
914446453 1:147754572-147754594 CTTCCTGAGGATTGGGACGTGGG + Intergenic
916818089 1:168372604-168372626 CTGACTGAGGAAATGGAGGAGGG + Intergenic
917677904 1:177337793-177337815 CTGCTTGAGGGAAGGGAATCAGG - Intergenic
920596838 1:207280236-207280258 CTGCCTGAAGAAGGGGATGAAGG + Intergenic
921949523 1:220915081-220915103 CTGCCTCAGTAAATGGAAGCGGG - Intergenic
923304338 1:232674399-232674421 CTGCCTGAGAAGAGGGACTGAGG - Intergenic
923686989 1:236160388-236160410 CTGCCTAATGACAGGGACCCCGG - Intronic
1063119193 10:3092859-3092881 CTGTCTGAGGAAAGGGGTGTGGG + Intronic
1063662935 10:8046328-8046350 GTGCCTGAGGAAAGTGACACCGG + Intergenic
1066387702 10:34955038-34955060 GAGCCTGAGGAAATGGACGTGGG - Intergenic
1066656348 10:37702229-37702251 CTGGCTGAGGACAGGGAGGAGGG - Intergenic
1071802868 10:89084110-89084132 CTGCCTCAGGAGAGGTATGCAGG + Intergenic
1072758235 10:98035332-98035354 CAGCCCCAGGAAAGGGATGCTGG + Intergenic
1075469640 10:122678381-122678403 CTGCCAGGGGAAAGGAAGGCAGG + Intergenic
1076178993 10:128391318-128391340 CTCCCTGAGGACAGTGAAGCAGG + Intergenic
1076294689 10:129375421-129375443 CTGCAAGAGGAAGGGGACTCAGG - Intergenic
1077015288 11:396589-396611 GTGCCTGTGGAGAGGGACGGTGG - Exonic
1077539479 11:3139772-3139794 CTGCCTGAAGGAAGAGAGGCCGG - Intronic
1077636452 11:3844825-3844847 GGGCCAGAGGAAAGGGAAGCAGG + Intergenic
1080425514 11:32150543-32150565 CTTACAGAGGAAAGGGATGCTGG + Intergenic
1081523326 11:43904286-43904308 TTGCCTGAGGAAAGGGATTTGGG + Intronic
1082740626 11:56907099-56907121 CTACCTGTGGAAAGGGAAGGTGG + Intergenic
1083616607 11:64029413-64029435 CTGCCCGAGGTAGGGGATGCAGG - Intronic
1083619313 11:64041088-64041110 CTGCCTCTGGAGAGTGACGCGGG - Intronic
1083635709 11:64119906-64119928 CTCCCTGAGTACTGGGACGCAGG - Intronic
1083876301 11:65525902-65525924 CTGTCTGGGGAAGGGGACACAGG - Exonic
1084374150 11:68764475-68764497 CAGCCTGGGGAAGGGGAAGCCGG + Intronic
1084891484 11:72239179-72239201 CTGCCTGGGGAATGGGACAGAGG - Exonic
1085381300 11:76121626-76121648 CTGCCTGAGGACCTGGATGCTGG - Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1086080976 11:82901707-82901729 CTTCCGGCGGAAAAGGACGCGGG + Exonic
1088641982 11:111881398-111881420 CTGCCTGTGGAAAGGCAAGTGGG + Intronic
1088939231 11:114436860-114436882 CTGCCAGAGGTAAGGGGCGGGGG - Intronic
1091245601 11:134091781-134091803 TTGCCTGAGGCAAGGGAAGAAGG + Intronic
1091779718 12:3206057-3206079 TAGCCTGAGGAAGGGGCCGCTGG + Intronic
1096069341 12:48766339-48766361 CTGGGTGAGGAAAGGGACAATGG + Exonic
1097388476 12:58979749-58979771 CAGACTGAGGAAATGGGCGCTGG + Intergenic
1098449978 12:70609440-70609462 CTGGCTGAGGCAAGGGACAAAGG - Intronic
1102646871 12:114409313-114409335 CTGGCTGAGAGAAAGGACGCGGG - Intergenic
1103779511 12:123389414-123389436 CTGCCTGGAGAAGGGGACCCGGG - Exonic
1103961541 12:124611880-124611902 CTGCCTGTGGAAGGGGATACAGG - Intergenic
1104919863 12:132285153-132285175 CTGCCTGAGGGAGGGCAGGCAGG - Intronic
1105024904 12:132841439-132841461 CCCCCTGAGGGAAGGGACGCAGG - Exonic
1106034304 13:26029874-26029896 CTCCATGAGGAAAGGGACTTTGG - Intergenic
1106285607 13:28316144-28316166 CTGCCTGAGCGTAGGGAAGCGGG - Intronic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1112368212 13:98773509-98773531 CTGTTGCAGGAAAGGGACGCCGG - Intergenic
1113440636 13:110325548-110325570 GTGGCTGAGGTAAAGGACGCTGG + Intronic
1113887733 13:113669878-113669900 CTGCCTGTGGAAAGGAGCCCGGG - Intronic
1114452123 14:22834187-22834209 CTGTCACAGGAAATGGACGCTGG + Exonic
1115752742 14:36507422-36507444 CTGCCAGGGGAAAGGGAAACAGG - Intronic
1117253170 14:53954811-53954833 CAGCCTCAGGAAAGGGAGGTCGG - Intronic
1118916935 14:70115592-70115614 GTGCCTGAGGAGAGGGACGATGG + Intronic
1119021035 14:71115052-71115074 CTGCATGAGGAAATGGAAGGAGG + Exonic
1119645669 14:76346618-76346640 CTGCCTGAGGGATGGGAAGGAGG - Intronic
1121319657 14:92984158-92984180 CTGCCTCAGGGAAGTGAGGCTGG + Intronic
1122293975 14:100694574-100694596 CTGCCTGGGCAAAGGCACACGGG + Intergenic
1123110458 14:105864733-105864755 GTGGCTGGGGACAGGGACGCCGG - Intergenic
1123572339 15:21626376-21626398 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1123608954 15:22068963-22068985 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1125336040 15:38627229-38627251 CTGCCTAAGGACAGGGAGGTGGG - Intergenic
1125770181 15:42159955-42159977 CGGCCTGAGGCAAGGGATGCAGG + Exonic
1125920568 15:43523109-43523131 CTGGCTGAACAAAGGGACACAGG + Exonic
1125928356 15:43582091-43582113 CTACCTTACGAAAGAGACGCTGG + Exonic
1125941522 15:43681926-43681948 CTACCTTACGAAAGAGACGCTGG + Intergenic
1126170069 15:45687964-45687986 CTGCCTGTGAACAGGGACACAGG + Intronic
1128113798 15:65093228-65093250 CTGCCTGAGGAAGAGGAGACAGG + Exonic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1130220664 15:82016870-82016892 ATGCCTGTGGCAAGGGATGCTGG + Intergenic
1130220818 15:82018104-82018126 ATGCCTGTGGCAAGGGATGCTGG + Intergenic
1202981195 15_KI270727v1_random:360763-360785 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1132536523 16:484182-484204 TTGCCTGAGAAAAGGGCCGTGGG - Intronic
1132842616 16:1985534-1985556 CTGCCTGAGGCCAGGGACACTGG + Intronic
1133164793 16:3938938-3938960 CTGCATGAAGAAAGGGGTGCCGG + Intergenic
1133231496 16:4369168-4369190 CTGCCTGAGGCAAGGAAGACTGG - Intronic
1134082342 16:11333717-11333739 CTGCCTGGGGAAAAGGGGGCCGG - Intronic
1136172380 16:28496767-28496789 CAACCCGAGGAAAGGGAGGCAGG + Exonic
1137237278 16:46626219-46626241 CTCCTTGAGGAAGGGGAAGCAGG - Intergenic
1137634774 16:49976281-49976303 CTGCCTGGAGACAGGGACGGGGG + Intergenic
1138272181 16:55703214-55703236 CTGCCTGGGGAAACGGGGGCAGG + Intronic
1139468484 16:67166301-67166323 CTGCCTGAGGAAGGGGTGGGAGG - Exonic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1142341964 16:89529454-89529476 CTGCCGGAAGAAAGAGAGGCAGG - Intronic
1142668334 17:1475086-1475108 CTGCCTGCTGAAAGGGCCTCAGG + Intronic
1142693298 17:1619969-1619991 CTGCCTGAGTAAAGGCACCAGGG + Intronic
1142697987 17:1644025-1644047 TTCCTTGAGGAAGGGGACGCAGG - Intronic
1144625502 17:16842429-16842451 CTGACTGAGGAGAGGGATCCAGG - Intergenic
1144643419 17:16952340-16952362 GTGGCTGAGGAAAGGGTGGCAGG - Intronic
1144880927 17:18430292-18430314 CTGACTGAGGAGAGGGATCCAGG + Intergenic
1145151305 17:20514095-20514117 CTGACTGAGGAGAGGGATCCAGG - Intergenic
1146468875 17:33108701-33108723 CAGCCTGAAGAAAGGTACGATGG + Intronic
1147341428 17:39755020-39755042 CTGGGAGAGGAAAGGGAGGCCGG - Intergenic
1148713713 17:49700442-49700464 CTGCCTGTTGAAAGGGATGCTGG - Intergenic
1148776324 17:50097447-50097469 CTGCCTGAGGAAGGTGAAGGAGG - Exonic
1151451693 17:74201967-74201989 CTGCCTGAAAAAGGGGAGGCGGG + Intergenic
1153990738 18:10397210-10397232 CTGGATGAGGAAAGAGAGGCGGG + Intergenic
1156645926 18:39162298-39162320 CAGCCTGAGGAAGGTGATGCAGG + Intergenic
1159914120 18:74173548-74173570 CTCCATGAGGAAAAGGAGGCAGG - Intergenic
1162357348 19:10194502-10194524 CTGCTTGAAGAAGGGGACCCCGG + Intronic
1162421758 19:10569361-10569383 CCTCCTGAGGGAAGGGAGGCAGG + Intergenic
1165127837 19:33613250-33613272 CTCTCTGAGGACAGGGACGGGGG + Intergenic
1165281488 19:34801991-34802013 CTTTCTGAGGAAAGGGCCTCAGG + Intergenic
1166091725 19:40513577-40513599 GTGCATGAGGAAGGGGACCCCGG - Intronic
1166840068 19:45691936-45691958 CTGCCTGAGGAGAGAGAGGCGGG + Exonic
1167569332 19:50277005-50277027 ATGCGTGAGGAAAGGGGCCCAGG - Intronic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925377777 2:3400516-3400538 CTGACTGAGGAAAGGCACCTGGG - Intronic
925856394 2:8133459-8133481 CTGGCTGAGGAAAAGGATCCTGG - Intergenic
926547558 2:14260634-14260656 CAGCTTGAGGAAAGGGATGAGGG + Intergenic
927001559 2:18800280-18800302 CTGCATGGAGAAATGGACGCAGG - Intergenic
927906378 2:26861405-26861427 CTGCCTGAAGGAAGGGATGAAGG - Intronic
928214140 2:29347260-29347282 CTGCCTGAGGAGAGAGATCCTGG + Intronic
928518376 2:32064319-32064341 CTCCCGCAGAAAAGGGACGCAGG - Intronic
930713778 2:54573763-54573785 GTGCCTGAGCAAAGAGCCGCAGG - Intronic
930957483 2:57219819-57219841 CTGCCTGAGGCAATGGACAAAGG + Intergenic
933273207 2:80255907-80255929 CTGCCAGAGGGAAGGGTGGCAGG - Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
934128959 2:88927937-88927959 ACACCTGAGGAAAGGGACACTGG + Intergenic
935581830 2:104762399-104762421 CTGCTTGAGGAAGGGGACCATGG - Intergenic
935729857 2:106056294-106056316 CTGTCAGCGGAAAGGGAGGCTGG + Intergenic
942447512 2:176087972-176087994 CTGCCCGAGGGGAGGGGCGCCGG + Intergenic
943087407 2:183329263-183329285 ATGCCTGAGGAGAGGGAAACAGG - Intergenic
944997198 2:205307083-205307105 CTTGGTGAGGAAAGGGAGGCAGG - Intronic
945824298 2:214701261-214701283 CTGCATCAGGTAAGGGACTCAGG + Intergenic
946012860 2:216580417-216580439 TTGCATGAGCAAAGGGACTCAGG + Intergenic
946164618 2:217856420-217856442 CTGTCTGTGGGAAGGGAAGCTGG - Intronic
946411656 2:219518182-219518204 CTGCTTGAGGACAGGGACTGGGG - Intronic
947271953 2:228346350-228346372 GTGCCTGAGGAAAGGGGTTCTGG + Intergenic
948135950 2:235636444-235636466 ATGCCTGTGGAAAGGGAAGTTGG + Intronic
948465468 2:238149800-238149822 GTGCCTGAGGAAGGGGAGGGAGG + Intronic
1169715096 20:8607132-8607154 CTGGCTGAGGAATGGGATGTGGG - Intronic
1172191800 20:33066226-33066248 CTGCCTGAGAAATGGGGCACAGG - Intronic
1172481371 20:35273874-35273896 CTGCTTGAGCCAAGGGAGGCAGG - Intronic
1173143417 20:40504369-40504391 CTGCCTGGTGAAAAGGATGCTGG + Intergenic
1173330049 20:42068243-42068265 CTGTCTGAGGAAAGGCACCATGG + Intergenic
1177222346 21:18210354-18210376 CTGCCTGGGGGATGGGATGCAGG + Intronic
1178377499 21:32079631-32079653 CTCCATGAGGACAGGGACTCGGG + Intergenic
1178911868 21:36681165-36681187 CTGCCAGAGAAGAGGGACCCTGG + Intergenic
1179669796 21:42938656-42938678 CTATCTGAGGAAAGGGAGGGGGG + Intergenic
1180078573 21:45475664-45475686 CTGGCTGGGGACAGGGATGCTGG + Intronic
1181266956 22:21636041-21636063 ATGGCTGAGGAAAGGGTCGAGGG - Intronic
1181431978 22:22887489-22887511 CTGACTCAGGAAAGGGCCACAGG + Intronic
1182130088 22:27844418-27844440 CTGCCTGAGGAAAGCACTGCCGG + Intergenic
1182303136 22:29349975-29349997 CTGCCTGGGGACAGGGATGGCGG - Intronic
1183105768 22:35613983-35614005 CAGCCTGTGGAAATGGACGGAGG + Intronic
1183160943 22:36112729-36112751 TTGCCTCTGGAAAGGGAAGCTGG - Intergenic
1183771046 22:39926079-39926101 CTCCCTGAGGAAAGGAACTGTGG + Intronic
1184244205 22:43227688-43227710 GTTCCTGGGGGAAGGGACGCTGG - Intronic
1184976965 22:48069183-48069205 CTGCATGAGGACACTGACGCCGG - Intergenic
1185184365 22:49388624-49388646 CTTCCTGAGGAAGAGGAAGCAGG - Intergenic
949588638 3:5469102-5469124 CTGCCTGATGCAAAGGATGCTGG - Intergenic
950263862 3:11560861-11560883 CTGCCTGTGGACAGGGCCTCGGG + Intronic
953553615 3:43924341-43924363 ATGCCTGAGGAGAGGGTCACTGG - Intergenic
958078412 3:88713106-88713128 CTGCCTTTGGAAAGGGAGGGAGG + Intergenic
961175072 3:124828493-124828515 TTGCCTGGGGTAAGGGAGGCAGG + Intronic
961750397 3:129090911-129090933 CTCCTTGAGGAAGGGGAAGCAGG - Exonic
962819380 3:139033329-139033351 CTACCTAAAGAAAGGGAGGCTGG - Intronic
963063875 3:141247031-141247053 CTGCCTGAGGCAGGGGAGGGAGG - Intronic
969258764 4:6020944-6020966 TTGCCTAAGGACAGGGAAGCAGG + Intergenic
969433837 4:7172585-7172607 CAGCCTCAGGAAAGGGATGCAGG - Intergenic
971142413 4:23938676-23938698 CTGCCTAATGAAAGGGACTATGG - Intergenic
973181603 4:47275384-47275406 CTGAATGAGGACAGGAACGCAGG - Intronic
973791803 4:54384951-54384973 CTGCCTGAGGACAGGGTAGTGGG - Intergenic
977051312 4:92131340-92131362 CTGCCTGAGGCCAGGCACGGTGG + Intergenic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
977693871 4:99946580-99946602 CTGCCGGAGGAAACGGAAGAAGG - Exonic
978279029 4:106987542-106987564 CTGCCTGAGGAAAGGGACGCAGG + Intronic
978833063 4:113112825-113112847 CTGCCTGAGGAAAGGAAACAAGG - Intronic
981756562 4:148146277-148146299 CTCCCTGTGGGAAGGGACACTGG + Intronic
982120439 4:152138005-152138027 CTGCCTGAGGAATGGGTAGGTGG + Intergenic
984444744 4:179822478-179822500 GTGTCTGAGGAAAGTGTCGCAGG + Intergenic
985520390 5:371499-371521 CTGCCCAGGGAATGGGACGCAGG - Intronic
986492799 5:8309004-8309026 CACCCTGAAGAAAGGGACGTAGG + Intergenic
986805554 5:11305445-11305467 CTGCCTGGGGAAATGGCTGCAGG - Intronic
989522961 5:42423046-42423068 CTGCTAGAGGACAGGGATGCAGG - Intergenic
989652963 5:43714004-43714026 CTGCGTAAGGAAAGGGACATTGG - Intergenic
991014740 5:61918706-61918728 CTGGCTGAGCAAACGGACTCAGG + Intergenic
991497905 5:67245601-67245623 ATGCCTGGGGAGAGGGATGCTGG + Intergenic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
994310101 5:98259501-98259523 CTGCCTGAAGAAAGAGACCTTGG - Intergenic
996212552 5:120829771-120829793 CTGCCTCAGGAAGGTGAGGCAGG - Intergenic
996282355 5:121745876-121745898 CTGCCAGAGTAATGGGAGGCAGG - Intergenic
998349766 5:141492815-141492837 CTGCGGGAGGAAGGGGCCGCTGG - Intronic
1000047918 5:157536656-157536678 CTGGATGGGGAAAGGGACACAGG - Intronic
1000568411 5:162880807-162880829 CTTCCTCAGGAAAGGGCCCCCGG - Intergenic
1001036516 5:168300531-168300553 CTGCCAAAGAAAAGGGACGGAGG + Intronic
1001746699 5:174098148-174098170 CTTGCTGAGGAAAGGCACACAGG + Intronic
1002853875 6:1020759-1020781 GTGGCTGAGGAAATGGACCCTGG - Intergenic
1003091509 6:3107655-3107677 CTGTGTGAGGGAAGGGACTCAGG - Intronic
1004303338 6:14477956-14477978 TTCCCTGAGGGAAGGGACTCCGG + Intergenic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1005070366 6:21856755-21856777 CTGCTTGAGGAAAGAGAAGCTGG + Intergenic
1008847260 6:55983081-55983103 ATGCCAGAGGAAAGTGACTCTGG - Intergenic
1013508834 6:110826392-110826414 CAGCCTGAGGAAACTGACACAGG - Intronic
1013726949 6:113110347-113110369 CTGCAAGAGGAAAGGGAGGGAGG - Intergenic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1014890379 6:126837117-126837139 CTACCTGAGGATAGGGGCACAGG - Intergenic
1015874155 6:137805862-137805884 CTGCCAAAGGAAAGGAAAGCAGG - Intergenic
1016908446 6:149173869-149173891 CTGCCTGGGGCAGGGGAGGCAGG + Intergenic
1017862402 6:158411287-158411309 CTGCTTGAGGAAAAGGACAGAGG - Intronic
1018049070 6:159991974-159991996 ATGCCTGAAGGAAGGGAGGCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018956108 6:168411550-168411572 CTGCCTGTGGAAAGTGACTGTGG + Intergenic
1019921542 7:4166505-4166527 CAGCCTGAGGAAAGGCTCACGGG + Intronic
1022535148 7:31093867-31093889 ATGGCTGAGGAAGGGGACCCTGG - Intronic
1022685081 7:32589536-32589558 CTGCCTGAGGTAATGTACACAGG + Intergenic
1022891278 7:34702395-34702417 CTTCCTTAGGAAAAGGAAGCTGG - Intronic
1029115942 7:98237116-98237138 CTGCCTGAGGTCAGGGAGACGGG - Intronic
1029977501 7:104848612-104848634 GTGTCTGAGGAAAGGGAGGGAGG + Intronic
1030102457 7:105958316-105958338 CTCCCTCAGGAAAGGCACTCAGG - Intronic
1031977383 7:128102667-128102689 CTGCCTGAGGAGAGGGGCTGGGG + Intergenic
1033170453 7:139079202-139079224 TTGCTTGAGGAAAGGGCAGCAGG + Intronic
1033596914 7:142865316-142865338 CTGCCTGAGGGAAGAGAGGGTGG + Intronic
1034566825 7:151922056-151922078 ATCCCTGAGGCAAGGGAAGCCGG + Intergenic
1034698278 7:153074192-153074214 CTCCCCGAGGAAAGGGGCCCTGG - Intergenic
1035171287 7:157018773-157018795 CTGCCTGAGCTAATGGACGAGGG + Intergenic
1037638693 8:20723046-20723068 CTGGCTGAGGAAAGGGTCACAGG + Intergenic
1037988369 8:23303536-23303558 AGGCCTGAGGAAAGGAAAGCCGG + Intronic
1038339097 8:26669211-26669233 CAGCTTGGGGAAAGGGACGGGGG + Intergenic
1038645038 8:29353862-29353884 CTGACTGATGAAAGAGAAGCTGG - Intergenic
1039358313 8:36845947-36845969 CTGCCTGACGAAAGAGAAGAGGG + Intronic
1040598896 8:48865248-48865270 CTGCCTGAGGGAAGGGGTACGGG + Intergenic
1042188713 8:66164227-66164249 CTGAAGGAGGAAGGGGACGCAGG - Intronic
1046027868 8:108746890-108746912 AGGCATGAGGAAAGGGACGTGGG - Intronic
1046910489 8:119621022-119621044 ATGTCGGAGGAAAGGGAAGCAGG - Intronic
1048276692 8:133071394-133071416 AGGCCTGAGGAAAGGGATGGAGG + Intronic
1048960281 8:139570985-139571007 CTGCCTGAGGAAAGGAACAATGG + Intergenic
1053194776 9:36108620-36108642 ATGCCTGAAGAAAGGGTCGGGGG - Intronic
1053198152 9:36136027-36136049 CCGCCTGAGGAAAGGCAGGGAGG + Intergenic
1053302679 9:36963006-36963028 ATGCCTGAGCAAGGGGCCGCAGG - Intronic
1055022372 9:71684023-71684045 CACCCTGTGGAAAGGGAAGCTGG + Exonic
1056383161 9:86074044-86074066 CTGCTTGAGGTGAGGAACGCTGG + Intronic
1056767880 9:89455791-89455813 CTGACTGAGGAATGGAACACCGG + Intronic
1057122181 9:92586379-92586401 CTGCCTGGGGCAAGGGATGGTGG + Intronic
1058419414 9:104820066-104820088 CAGCCTGGGGACAGGGAGGCAGG + Exonic
1058522743 9:105828371-105828393 CTGCTTGAGGAAAGGGGAGGGGG - Intergenic
1060112296 9:120914823-120914845 CAGCCTGAGGGAAGGGATACAGG + Intronic
1060468688 9:123930003-123930025 CAGCCTGAGGGAAGGGAGGAAGG - Exonic
1060718300 9:125955275-125955297 CTGGCTGAGGAAGAGGAAGCGGG - Intronic
1061077324 9:128349570-128349592 CTGCTTGAGGGCAGGGACTCTGG + Intronic
1061200116 9:129133170-129133192 CTGCCTCAGGGAAGGAAGGCGGG - Intronic
1061573605 9:131492642-131492664 AAGTCTGAGGAAAGAGACGCTGG - Intronic
1061669364 9:132180015-132180037 CACCCTGTGGAAAGGGACTCAGG + Intronic
1062403416 9:136382349-136382371 CTGCCTGAGGCGAGGCACGCGGG + Intronic
1185650776 X:1646376-1646398 CTGCCTCAGGAAAGAGAAGCTGG - Intergenic
1192159230 X:68770301-68770323 CTGCCTGAAGTAAGGGAGGTGGG - Intergenic
1192318175 X:70067643-70067665 CTGGCTGGGGAAAGGGGCCCTGG + Intergenic
1194646984 X:96469778-96469800 ATACCTGAGGAAATGGACGTAGG - Intergenic
1197921366 X:131598041-131598063 CTGCCTGCAGAAAGGGAAACTGG + Intergenic
1198612049 X:138412058-138412080 CTGCCTGTGGAAAGGAAGACTGG + Intergenic
1199733664 X:150663191-150663213 CTGCCTGAAGACAGGGGCGCAGG - Intronic
1200226707 X:154421476-154421498 TTGCCTGAGGAAAGGGCCTGTGG - Exonic
1201733501 Y:17231600-17231622 CTCCCCAAGGAAAGGGACCCTGG - Intergenic
1201995080 Y:20077615-20077637 CTGCCCGAAGAAAGGAACTCTGG + Intergenic
1201995322 Y:20080873-20080895 CTGCCAGAAGAAAGGAACACTGG + Intergenic
1201997418 Y:20108841-20108863 CTGCCAGAAGAAAGAGACTCTGG - Intergenic
1201999850 Y:20141001-20141023 CTGCCAGAAGAAAGAAACGCTGG - Intergenic
1203337599 Y_KI270740v1_random:21884-21906 CTGCCAGAAGAAAGGAACACTGG - Intergenic
1203338715 Y_KI270740v1_random:36548-36570 CTGCCAGAAGAAAGGAACTCTGG - Intergenic