ID: 978281716

View in Genome Browser
Species Human (GRCh38)
Location 4:107024691-107024713
Sequence CTTTGCAAAGAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978281714_978281716 15 Left 978281714 4:107024653-107024675 CCTCTAATGATGTTGAGGCAAAT 0: 1
1: 0
2: 0
3: 10
4: 165
Right 978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG 0: 1
1: 0
2: 2
3: 45
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978281716 Original CRISPR CTTTGCAAAGAGATGGAGAA AGG Intronic
902551921 1:17224346-17224368 ATCTGCAAAGAGATGGAGAGGGG - Exonic
904047502 1:27617268-27617290 CTTTGGAAAGATTGGGAGAAAGG - Exonic
904319266 1:29685942-29685964 CCTTGCAGAGATGTGGAGAATGG + Intergenic
904505949 1:30954168-30954190 TTTTGCACAAAGATTGAGAAGGG + Intronic
904562509 1:31408264-31408286 CTGTGCAGAGAGATGGACAGAGG - Intergenic
904621054 1:31775585-31775607 CTTTCCAGAGAGATGGGGAGAGG + Intergenic
905112240 1:35604240-35604262 CTTTGGGTATAGATGGAGAATGG - Intronic
905292656 1:36933238-36933260 CTTGGCAGAGAGGTGGGGAATGG - Intronic
905467470 1:38166331-38166353 CTTTTCATAGGGAGGGAGAAGGG - Intergenic
906430701 1:45753710-45753732 ATTTGCAAAAAGAAGAAGAAGGG + Intergenic
906562586 1:46770136-46770158 CTTGGCAAATGGAAGGAGAAGGG - Intronic
907261761 1:53223550-53223572 CTTAACAAAGAGATGGAAAAAGG + Intergenic
907542706 1:55230466-55230488 CTCTGCCAGGAGATGGAGATTGG + Intergenic
907891173 1:58637764-58637786 CCTTTCAAAGAGTGGGAGAAGGG - Intergenic
908083660 1:60607714-60607736 GTTAGCTAAGATATGGAGAAAGG - Intergenic
908083904 1:60609951-60609973 ATTAGCTAAGATATGGAGAAAGG - Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
908358432 1:63344708-63344730 CTTTCCAGAGAGGTTGAGAAGGG + Intergenic
909142345 1:71884145-71884167 GTTAGGAAAGAGATGGAGTAAGG - Intronic
909738692 1:79000470-79000492 CTTTGAAAAGAGAAGGAAAGGGG - Intronic
909940500 1:81605522-81605544 CTTTTCAATGTGATGAAGAAGGG - Intronic
910326798 1:86018447-86018469 CTCTTTAAAGAGATAGAGAAAGG + Intronic
911038963 1:93577533-93577555 CTTTGCAAAGTCCTTGAGAAAGG - Intronic
911140069 1:94490900-94490922 GTTGGCAAAGATGTGGAGAAAGG - Intronic
911185496 1:94900038-94900060 CCTTGGACAGAGCTGGAGAAAGG + Intronic
911775016 1:101797982-101798004 CTGGGCATAGAGATGGAGATCGG + Intergenic
911801332 1:102142262-102142284 CTTTGCAAGGACATGGATGAAGG + Intergenic
911816113 1:102353468-102353490 ATTTGCAAATAGATGCAAAATGG + Intergenic
911967539 1:104386754-104386776 CTTTGCCGAGAGATGCATAAAGG - Intergenic
912790950 1:112650135-112650157 CTTTGTAAAGAGTTGGATAATGG + Intronic
913360435 1:117974933-117974955 GTTTGCATAGAGATGGAGGATGG - Intronic
913566972 1:120081854-120081876 ATTTGCACAGAGATGGGGAAAGG - Intergenic
913631158 1:120711695-120711717 ATTTGCACAGAGATGGGGAAAGG + Intergenic
914287724 1:146242560-146242582 ATTTGCACAGAGATGGGGAAAGG - Intergenic
914434627 1:147648932-147648954 CTTTCCTAAGAGATGGATACTGG - Intronic
914548758 1:148693306-148693328 ATTTGCACAGAGATGGGGAAAGG - Intergenic
914617922 1:149378408-149378430 ATTTGCACAGAGATGGGGAAAGG + Intergenic
915054227 1:153111029-153111051 CTTTGCAGGGAGATGGATGAAGG + Intergenic
915313106 1:155014271-155014293 CCTTCCAAAGAGATGGGGAATGG + Intronic
915357764 1:155266441-155266463 CTTTCCCAAGAAAGGGAGAAAGG + Intronic
916172413 1:162010892-162010914 CTTGGCACAGAGATGGATAAGGG + Intronic
916818495 1:168375605-168375627 CTTTGAAAGGAGGTGGAGAAAGG + Intergenic
917702602 1:177596481-177596503 CTTTTCAAAGAAATGCAGATTGG + Intergenic
917794478 1:178522588-178522610 CTTAGCAAAGAGATGAAACAAGG - Exonic
917888862 1:179416973-179416995 GCTTGCAAAGATGTGGAGAAAGG - Intronic
918579417 1:186108569-186108591 CTTGGCTCAGAAATGGAGAACGG + Exonic
919345877 1:196377647-196377669 CTTTGCAAGCAGAAAGAGAAGGG + Intronic
919429890 1:197479456-197479478 CTATCAAAAGAGATGGAGAGGGG - Intergenic
919990286 1:202704605-202704627 CCTTGCAAAGGCAGGGAGAATGG - Intronic
920086412 1:203421059-203421081 CTTTGCAAACATGAGGAGAAAGG + Intergenic
920121423 1:203661575-203661597 CTTTTCAAAGAGCAGGAGAAAGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
921539731 1:216398997-216399019 CTTAGTAAAGAGTTGGAGCATGG - Intronic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
923126665 1:231039913-231039935 CTCCGCAAAGAGATGGTGAGTGG - Exonic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
924849059 1:247806057-247806079 GTTAGCAAGGAGGTGGAGAAAGG - Intergenic
1064005517 10:11696062-11696084 TTTTACCAAGAGAGGGAGAAAGG - Intergenic
1064317931 10:14275510-14275532 CAGTGCAAAGAAAGGGAGAAAGG + Intronic
1064409196 10:15090783-15090805 CTAGGCAATGAGATGGGGAATGG - Intergenic
1064596743 10:16953159-16953181 CTTTGGAGAGAGATGGGGTAAGG + Intronic
1064754480 10:18561901-18561923 CAATGGAAAGAAATGGAGAATGG + Intronic
1065323724 10:24532423-24532445 ATTTCCAAAGAGATGCAGTATGG + Intronic
1065847759 10:29760518-29760540 CTTTGCAAATGGAAGGGGAAAGG + Intergenic
1065953410 10:30673010-30673032 CCTTCCAAAGTGATGGAGAAGGG - Intergenic
1066056085 10:31681418-31681440 CCCTGCACAGAGAAGGAGAAGGG - Intergenic
1067319360 10:45203124-45203146 CTTTGCAAGGACATGGATGAAGG - Intergenic
1067331600 10:45327030-45327052 CTTTGCAGAGACATGGATGAAGG - Intergenic
1069060368 10:63888519-63888541 CTTTGCAAAGGCCTGGAGACAGG + Intergenic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1072365764 10:94707423-94707445 GGTGGCAAAGAGATGGAAAAGGG + Intronic
1075131684 10:119745444-119745466 ATTTGAAAAGAGGTGGAGATTGG - Intronic
1076604426 10:131680195-131680217 CTTAGCACAGACATGGAGACAGG + Intergenic
1077820629 11:5736401-5736423 ATTTCTAAAGAGATGAAGAAAGG + Intronic
1077881242 11:6352260-6352282 CTTTAGAATGAGGTGGAGAAAGG + Intergenic
1078081083 11:8205195-8205217 CTTAGCAAATGGAAGGAGAAGGG - Intergenic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1079215279 11:18504616-18504638 CTTTGCAAAGGTATGCAAAATGG - Intronic
1079976311 11:27095819-27095841 CTATGCAGAGAAATGGAAAAAGG - Intronic
1081414825 11:42801831-42801853 CTTTACAAAGAGAAGGACCAGGG - Intergenic
1082956984 11:58880349-58880371 CATTGCAAGGGGATGGAGTAGGG + Intronic
1082963849 11:58945428-58945450 CATTGCAAGGGGATGGAGTAGGG + Intronic
1084354822 11:68630968-68630990 CTTTGCCAAGAGATACATAAAGG - Intergenic
1085380859 11:76116568-76116590 CTTTGAAAAGAGAAGGAGAGAGG + Intronic
1086036086 11:82416026-82416048 ACTGGCAAAGATATGGAGAAAGG + Intergenic
1086531546 11:87792169-87792191 CTTTGCAGAGACATGGATGAAGG - Intergenic
1087424235 11:97968627-97968649 ATTAGCTAAGAAATGGAGAAGGG + Intergenic
1087790956 11:102406100-102406122 ACCTGCAAAGAGATGCAGAATGG + Intronic
1088428984 11:109736598-109736620 CTGTGAAGAGAGATGAAGAATGG + Intergenic
1088987750 11:114925003-114925025 CATTTCAAAGGGATGTAGAAAGG + Intergenic
1089247684 11:117134313-117134335 CATTGCAAAGAAATGTACAAGGG + Intergenic
1089308992 11:117545543-117545565 CTCTGCAAAGACATGAAGATGGG + Intronic
1089367089 11:117927483-117927505 CTTGGAAAAGAGGTGGAGAAGGG - Intronic
1090086003 11:123651758-123651780 GTTTGCAAAGAAACTGAGAATGG + Intronic
1092405214 12:8217054-8217076 TTTTCCAAAGAGACAGAGAATGG + Intergenic
1092515625 12:9208642-9208664 ATTTTGAAAGAGATGGAGAAAGG - Intergenic
1092707880 12:11304185-11304207 GTTGGCAAGGATATGGAGAAAGG + Intergenic
1094194811 12:27737221-27737243 CTTAGCACTGAGATGGTGAAGGG + Intronic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1094723559 12:33089686-33089708 CTTTGCCAAGAGATACATAAAGG + Intergenic
1094826378 12:34272333-34272355 CTTTGCCAAGAGATACATAAAGG - Intergenic
1095168907 12:39009838-39009860 TTTAGCACAGAGATGAAGAATGG - Intergenic
1095232269 12:39753506-39753528 TATGGAAAAGAGATGGAGAAAGG + Intronic
1097495260 12:60323472-60323494 CATTGCAAAGAGCTGGTGACAGG - Intergenic
1098194322 12:67983737-67983759 CTTGGCTATGAGATGGACAATGG - Intergenic
1098493526 12:71109794-71109816 TTTCCCCAAGAGATGGAGAATGG + Intronic
1099613043 12:84899528-84899550 CTTGGCAATGAAATGGAAAAAGG - Intronic
1099754029 12:86817796-86817818 CTTTGCAAAGATTTTGAGAGAGG + Intronic
1100218555 12:92479292-92479314 CTTTGCAAACAGATGGAATTTGG - Intergenic
1100532262 12:95471625-95471647 GAATGCAAAGAGGTGGAGAAGGG - Intergenic
1100744008 12:97625684-97625706 TTGTGCCAAGAGATGGAGAGAGG + Intergenic
1101253644 12:102957461-102957483 GTTTGCAAGGAGCGGGAGAAAGG + Intronic
1101614600 12:106324244-106324266 GTTTGCAAAGAAATGAGGAAGGG + Intronic
1102843598 12:116153288-116153310 CTTGGCAAATAGACTGAGAAAGG - Intronic
1102954728 12:117052170-117052192 CTTTGCAAAAAGAGTGAAAATGG - Intronic
1103152384 12:118652001-118652023 CTAAGCAGAGAGAGGGAGAAGGG + Intergenic
1103897899 12:124286101-124286123 CTCTGCAAAGAGCCTGAGAAAGG - Intronic
1103947920 12:124537350-124537372 CTTTGGCACGAGGTGGAGAAGGG - Intronic
1104380323 12:128301688-128301710 CTTGGCAAACAGATGCAGAATGG + Intronic
1105586254 13:21746344-21746366 CTTTCCAAAGAAATAGAGAGAGG - Intergenic
1106107245 13:26743242-26743264 CCCGGCAGAGAGATGGAGAAGGG + Intergenic
1106181027 13:27369476-27369498 CTTTTCAAAGATATGGAGCGGGG - Intergenic
1106567104 13:30895781-30895803 CTTAGCAGAGAGATGGAGTGGGG - Intergenic
1107317163 13:39145519-39145541 CTTTGAAAAGATGTGGTGAAAGG - Intergenic
1107434674 13:40371944-40371966 CTATGCCAAGAGATGGCCAATGG + Intergenic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109041985 13:57350541-57350563 CTTCGCTGAGAGATGGAGTAGGG - Intergenic
1110146062 13:72191484-72191506 CTTTTCCAAAAGATGTAGAATGG - Intergenic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1110657763 13:78020441-78020463 CTTTGGATAGGGATGGTGAAAGG + Intergenic
1111029185 13:82573600-82573622 CTTTGCAAAAACATGGATGAAGG - Intergenic
1111043341 13:82780979-82781001 TTTTGGAAAGAAATGGAGGAGGG - Intergenic
1111084404 13:83355470-83355492 CTTTGCAAACAAATGGCAAATGG - Intergenic
1111143651 13:84154538-84154560 CTTTGCATGGGGATGGGGAATGG + Intergenic
1111445039 13:88336130-88336152 CTTTAGAAAGAGGTGGAAAAGGG + Intergenic
1111756781 13:92406921-92406943 ATCTGCAAAGAGATGAATAATGG - Intronic
1111963180 13:94833825-94833847 CTATTCAAAGGGAAGGAGAAGGG + Intergenic
1112108181 13:96265053-96265075 CTTTGCAGAGGTATGAAGAATGG - Intronic
1113202798 13:107885817-107885839 CTCTACAAAGAAATGGAGAATGG + Intergenic
1113254338 13:108490755-108490777 CGCTACAAGGAGATGGAGAAAGG + Intergenic
1114778271 14:25511392-25511414 ATTTGCAAAAACATGGAGACAGG - Intergenic
1115340458 14:32288071-32288093 CTTTGCAAGGACATGGATGAAGG - Intergenic
1116446054 14:45013125-45013147 ATTTGCAAAGAGATAGGAAATGG - Intronic
1116735395 14:48684283-48684305 CTTTGGAAAGAAAAAGAGAACGG - Intergenic
1117444725 14:55793111-55793133 CTTTGCAGAAACATGGACAATGG + Intergenic
1117836523 14:59812853-59812875 ATTTGCAACGAAATGGAGAGTGG + Intronic
1118435960 14:65771087-65771109 CTTTTCAAGGAGGTAGAGAAAGG - Intergenic
1118461066 14:65987501-65987523 CATTGCAAAGAGTGGGAGGAGGG + Intronic
1118787389 14:69057264-69057286 CTCTGCAAAGAGATGTCTAAGGG + Intronic
1120488989 14:85152537-85152559 GTTGGCAAAGATGTGGAGAAAGG + Intergenic
1121751354 14:96360093-96360115 CTTTGTAAAGAGAAAGTGAATGG + Intronic
1121979137 14:98438885-98438907 TTTTGCATAGATATTGAGAATGG + Intergenic
1123508004 15:20964846-20964868 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123565222 15:21538588-21538610 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123601485 15:21975875-21975897 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1123959594 15:25383003-25383025 TTTTTCAAAGAGTTTGAGAAGGG - Intronic
1124425745 15:29561104-29561126 GTTGGCAAAGATACGGAGAAAGG + Intronic
1125438854 15:39679180-39679202 CTTTTAAGAAAGATGGAGAATGG + Intronic
1125647057 15:41281557-41281579 CACTGCAAAGTGATGGAAAAGGG + Exonic
1126976476 15:54187565-54187587 CTATGCAAAGGGAGGTAGAAAGG - Intronic
1127581770 15:60345381-60345403 CTTTGCAAAGAGAAGGAAAAGGG - Intergenic
1129179551 15:73865326-73865348 ATTTGCAAACAGATGGAGTTGGG + Intergenic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1130194354 15:81764929-81764951 CTTGGCAAGGAGATGGGAAAAGG - Intergenic
1130452533 15:84070970-84070992 CTTTTCAAAGACATGAAAAATGG + Intergenic
1131336322 15:91552819-91552841 CTTTGCAGAGGGAAGGAGACTGG + Intergenic
1131687087 15:94779755-94779777 TTTTGGAAAGAGGAGGAGAAAGG + Intergenic
1202973593 15_KI270727v1_random:265694-265716 CTTTCCCAGGAGATGGAGCATGG - Intergenic
1133131485 16:3678801-3678823 CTTTGCCCAGAGCTGGAAAAGGG + Intronic
1133238500 16:4401226-4401248 ATGAGCAAAGAGGTGGAGAAAGG + Intronic
1133841769 16:9416548-9416570 CATTGCAGAGAGAGGGAGAATGG + Intergenic
1134359073 16:13513679-13513701 CTTTGCAAGGACATGGATTAAGG + Intergenic
1134364866 16:13568016-13568038 CTTTTCAAAGACATGGGAAAGGG - Intergenic
1134611495 16:15612629-15612651 CTTTGCAAAATGATGGTGATAGG + Exonic
1136517093 16:30774803-30774825 CTTGGCAGAGAAATGGAGATTGG - Exonic
1137573308 16:49580559-49580581 CATTGCCAAGGGATGAAGAAAGG + Intronic
1139229722 16:65272149-65272171 CTCTTCAAAGGCATGGAGAAGGG + Intergenic
1141799726 16:86298573-86298595 CATTGCAGAAAGAGGGAGAAAGG + Intergenic
1142474933 17:183046-183068 CTTTCCAAAGGAAGGGAGAAGGG - Intergenic
1142822359 17:2480241-2480263 CCTTGCAAAAAGATGGATGATGG + Intronic
1143110174 17:4548560-4548582 TTTTCCAAAGGGAAGGAGAACGG + Exonic
1144133727 17:12272572-12272594 CTTTGCAAGGACATGGATGAAGG - Intergenic
1144216896 17:13064145-13064167 GTTTGTAATGAGATGAAGAATGG + Intergenic
1144577000 17:16435676-16435698 GTCAGGAAAGAGATGGAGAAAGG - Intronic
1144792674 17:17869799-17869821 CTGTACCAAGTGATGGAGAACGG - Intronic
1146147592 17:30434684-30434706 CTTGGCAATTAGATGGTGAATGG + Intronic
1146892243 17:36513716-36513738 CTTTGCAAATCTGTGGAGAAGGG + Exonic
1147510268 17:41062578-41062600 AACTGCAAAGAGGTGGAGAAAGG - Intergenic
1147586518 17:41656411-41656433 CATTGCTGAGAGAGGGAGAAAGG - Intergenic
1149392567 17:56206748-56206770 CTTTGGCAAGAGATGGGGATGGG + Intronic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1153545983 18:6205222-6205244 CTTTGAATATGGATGGAGAAAGG + Intronic
1154021027 18:10664021-10664043 CTTTGCTAAGAGCTGCAGGAGGG + Intergenic
1154065712 18:11105105-11105127 CATAGCCAAGAAATGGAGAAGGG + Intronic
1154465716 18:14641573-14641595 CTTTGCGAAGAGATGGTGAGGGG - Intergenic
1154966931 18:21367826-21367848 CTTTGAAGGGAAATGGAGAAGGG + Intronic
1155313445 18:24547484-24547506 CATGACAAAGAGATTGAGAAAGG + Intergenic
1155622257 18:27793313-27793335 ATTAGCAAAGAGATTGAGATGGG + Intergenic
1155871922 18:31041202-31041224 CTTTGCGAAGGGATTGAGGATGG - Intronic
1155975958 18:32132163-32132185 TTTTGAAAAAAGATGGGGAAGGG + Intronic
1156107143 18:33676774-33676796 CTTTGCTAAGACAAGGAGAGAGG - Intronic
1156583451 18:38406128-38406150 ATTTGGAAAGTGGTGGAGAAAGG + Intergenic
1156627749 18:38930005-38930027 GTTGGCAAAGATGTGGAGAAAGG + Intergenic
1157449180 18:47772679-47772701 CCCTCCCAAGAGATGGAGAATGG - Intergenic
1157881941 18:51329022-51329044 CTCAGGAAAGAGATGAAGAAAGG + Intergenic
1157989070 18:52473565-52473587 CTTTTCACACAGCTGGAGAAAGG + Intronic
1158074146 18:53509127-53509149 CTTTGCAGAGAGTTGGTGCAGGG - Intronic
1158216974 18:55110638-55110660 CTCTCCAAATAGATGGAGAGAGG - Intergenic
1158275466 18:55762252-55762274 CTTTGAAAAATAATGGAGAAGGG - Intergenic
1158500136 18:57993558-57993580 CTTTGCATAGAGCAGGAAAATGG - Intergenic
1158665970 18:59433109-59433131 TTTTGCAGAGAGAAGGAGGAAGG + Exonic
1160369851 18:78363035-78363057 CTTTGCTAAAAGATGGAGTTGGG - Intergenic
1161157827 19:2742560-2742582 GTTGACAAAAAGATGGAGAAGGG + Intergenic
1161241650 19:3226410-3226432 TTTTGAAAAGAGATGGGGAATGG - Intronic
1161358689 19:3834090-3834112 CTTGGCAAGGAAATGGAGAGGGG + Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1162120234 19:8461081-8461103 CAGTGCAAAGAAATGAAGAACGG - Intronic
1162262920 19:9547220-9547242 CTTTGCCGAGAGATGCACAAAGG - Intergenic
1164082951 19:21876301-21876323 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164190931 19:22916418-22916440 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1166039813 19:40195012-40195034 CTTTACAAAGATCTGGGGAAGGG + Intronic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
1166397006 19:42448793-42448815 CTTTGCCAAGAGATACATAAAGG + Intergenic
1167015591 19:46838984-46839006 CGATGCAAAGAGATGGCAAAAGG + Intronic
1167560685 19:50225217-50225239 GTTTGTAAACATATGGAGAAAGG - Intronic
1167968795 19:53172403-53172425 GTTAGCAAAGATATGGAGACTGG - Intronic
1168151442 19:54451015-54451037 CTTCCCAAAGGGAAGGAGAAGGG - Intronic
1168495824 19:56849251-56849273 GTTGGCAAAGATATGGAGAAAGG - Intergenic
925795028 2:7531930-7531952 CTTTGCAGAGAGTTGTTGAATGG - Intergenic
925815294 2:7741633-7741655 TTTGGCAAAGAGGTAGAGAAAGG - Intergenic
925822816 2:7817094-7817116 CATTGTAAAGAGGTGGAGCATGG + Intergenic
926381296 2:12292767-12292789 CTTTGCAGGGACATGGATAAAGG + Intergenic
927705851 2:25296210-25296232 CTTTGGAGACAGTTGGAGAAGGG + Intronic
928382195 2:30828027-30828049 ATTTGCACAGAGAGAGAGAAAGG - Intergenic
928817446 2:35316166-35316188 CTTATCAAAGAGATGTACAATGG + Intergenic
929617828 2:43326304-43326326 CTTGGCAGAGAGTTGGAGAATGG + Intronic
929943932 2:46356309-46356331 CTTTTGAAAGAGATAGAGGAGGG - Intronic
930733412 2:54750582-54750604 CACAGCCAAGAGATGGAGAAAGG - Intronic
930825444 2:55692894-55692916 CGATGCAAAGAGATGGCAAAAGG - Intronic
931196198 2:60054225-60054247 CACTGCAGAGAGAAGGAGAAAGG - Intergenic
932593687 2:73081418-73081440 CTCTGCAAAGAGGTGAGGAACGG + Intronic
932814983 2:74854356-74854378 TTCCGCAAGGAGATGGAGAAAGG + Exonic
932854927 2:75223154-75223176 CTTTGCAAAGTGGAAGAGAAAGG + Intergenic
933288989 2:80415566-80415588 GTTGGCAAGGATATGGAGAAAGG + Intronic
933413866 2:81959488-81959510 CTTTGCCAATAGATGGTGATGGG + Intergenic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
935535216 2:104285669-104285691 CACTGCCAAGAGAAGGAGAAAGG - Intergenic
935920642 2:108009610-108009632 CTTTGCAGAGACATGGATGAAGG - Intronic
935922302 2:108029489-108029511 CTTAGCATAGAGATGGCAAATGG + Intergenic
936758028 2:115737904-115737926 CTCTGCATAGAGGTAGAGAAAGG - Intronic
937936601 2:127250346-127250368 ATTTCCAAAGAACTGGAGAAGGG - Intergenic
938311864 2:130295897-130295919 CTTTGCAACGGGAAGGGGAAGGG - Intergenic
938702506 2:133892350-133892372 TTCTTCAAGGAGATGGAGAAGGG - Intergenic
939174582 2:138734795-138734817 ATTTGCAAAGAGATGCAATATGG + Intronic
940432286 2:153606938-153606960 ATATGAAAAGAGATGAAGAATGG - Intergenic
940628441 2:156206968-156206990 ATGATCAAAGAGATGGAGAATGG - Intergenic
940751764 2:157633909-157633931 GTTGGCAAAGAGGTGGAGAAAGG - Intergenic
941455537 2:165709433-165709455 CTTTGCCAAGAGATACACAAAGG + Intergenic
942299900 2:174551282-174551304 CTTAGCAGAGAAAAGGAGAAAGG - Intergenic
943866822 2:192935666-192935688 CTATACAAAGAGATAAAGAAGGG - Intergenic
944120437 2:196234868-196234890 CTTTGCAAAGTTGTGGGGAAGGG - Intronic
944366864 2:198931043-198931065 TTTGGCAAAGGGATGCAGAAGGG - Intergenic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945711974 2:213307994-213308016 CTTGGGAAAGAGAAGGCGAAAGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948911800 2:241008638-241008660 CTTTGCAAAGAACAAGAGAATGG - Intronic
1169344208 20:4817572-4817594 CTTTGCATAGTGATTCAGAAAGG + Intronic
1169882717 20:10365067-10365089 GTTTGCAGAGAATTGGAGAATGG - Intergenic
1170147371 20:13191094-13191116 GCTTGCAAGGATATGGAGAAAGG + Intergenic
1170155653 20:13266951-13266973 CTTTGAGAAGAGATAAAGAAAGG + Intronic
1173066564 20:39718685-39718707 CTTTGCAGGCACATGGAGAAGGG + Intergenic
1174716792 20:52767374-52767396 CTTTTGATAGAGAAGGAGAAAGG + Intergenic
1174777517 20:53358643-53358665 TTTTTCAAAAAGATGAAGAACGG - Intronic
1174896294 20:54453094-54453116 CATCTCAAAGGGATGGAGAAAGG - Intergenic
1174988666 20:55485028-55485050 ATTTGCAAAGAAAGGAAGAATGG + Intergenic
1175456775 20:59121426-59121448 CATTGCAAAGAGAATGAGAGAGG - Intergenic
1175619326 20:60430331-60430353 CTTTGCTAAGGGAGGGAGAGAGG - Intergenic
1176808873 21:13517017-13517039 CTTTGCGAAGAGATGGTGAGGGG + Intergenic
1176888707 21:14287640-14287662 CTTTGAAAAACAATGGAGAAAGG + Intergenic
1177262918 21:18752473-18752495 CTTTTGAAAGAGATGGATCATGG - Intergenic
1177883229 21:26718805-26718827 CTTTGCAAAGACAGGGGGAAGGG - Intergenic
1179100872 21:38354816-38354838 CTGAGCCAAAAGATGGAGAAAGG - Intergenic
1179633317 21:42691954-42691976 CTTTGGATGGAGATGGTGAAGGG - Intronic
1183622392 22:38982129-38982151 AATTGCAAAGAGAAAGAGAAAGG - Intronic
1183714313 22:39524756-39524778 CTTGGCAGACAGATGGAGAGAGG - Intergenic
949263824 3:2134372-2134394 CTTTTCAAAGAGAGGCAGACAGG + Intronic
949957425 3:9280402-9280424 GTTTGCAAAGAGATGGGAAGGGG - Intronic
950168240 3:10817299-10817321 CTCTGCATAGAGATGTAGAAGGG + Intronic
950313955 3:11984000-11984022 CATAGCAGAGAGATGGAGAAAGG + Intergenic
950985477 3:17359841-17359863 TTATTCAAAGAGTTGGAGAATGG + Intronic
951988938 3:28653959-28653981 CTTTACAAAGAAATAGAGGAAGG - Intergenic
952331242 3:32366242-32366264 CCTTGGAAAGAAATGGGGAAGGG - Intronic
952531829 3:34270905-34270927 CTTTGGAAAGACAAAGAGAAAGG - Intergenic
952946689 3:38482583-38482605 CTTTGCAGGGGGGTGGAGAAGGG + Intronic
954904955 3:54053423-54053445 CTTTTCCAAGAGAGGGAGGAGGG + Intergenic
955401377 3:58594028-58594050 CTTTGCCGAGAGATGCACAAAGG - Intronic
955613536 3:60782323-60782345 CTTGGCAAGGATATGGAGAAAGG + Intronic
955932688 3:64073509-64073531 TTTGGCAAAGTGATGGAGGATGG + Intergenic
956905642 3:73762469-73762491 GTCTGCAAAGAACTGGAGAATGG - Intergenic
957162642 3:76629966-76629988 ATGTCAAAAGAGATGGAGAAAGG - Intronic
957171065 3:76737022-76737044 CTCTGCAAAGTTATTGAGAATGG + Intronic
957202609 3:77156168-77156190 ATTTGAAAGGAGAAGGAGAATGG - Intronic
957279536 3:78132367-78132389 TTTTGCAATGAGATAGAGATGGG - Intergenic
957314210 3:78556845-78556867 CTTTGCACAGAAATGTATAAGGG + Intergenic
958658073 3:97028531-97028553 CCTTGGAAAGAGAAAGAGAAAGG - Intronic
958818614 3:98947027-98947049 AGTAGCAAAGTGATGGAGAATGG + Intergenic
959012413 3:101093581-101093603 TTTGGCAAGGATATGGAGAATGG + Intergenic
959534415 3:107469231-107469253 AAAAGCAAAGAGATGGAGAAGGG + Intergenic
959554650 3:107702823-107702845 CCTTTCATAGAGAGGGAGAATGG + Intronic
960221478 3:115115017-115115039 CTTTGTAATAAGATGGAGAATGG - Intronic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961558361 3:127712020-127712042 TTTTGCAAAGACAGGGAGACTGG - Intronic
963431532 3:145211795-145211817 TTTTGCAATGAGAAGAAGAATGG + Intergenic
964360602 3:155891965-155891987 TTTTGCAGATAAATGGAGAAGGG + Intronic
964718078 3:159743634-159743656 AGTTGTAAAGAGCTGGAGAACGG + Intronic
965174131 3:165308648-165308670 CCTAACAAAGATATGGAGAAAGG + Intergenic
966067458 3:175834346-175834368 CTTTGCCAAGAGATACATAAAGG - Intergenic
966875436 3:184319194-184319216 CTTTGTAAAGGGCTGGAGACAGG + Intronic
966916613 3:184587770-184587792 CTTGGCAGAGAGAAGGAGAAAGG + Intronic
967707418 3:192667645-192667667 CTATGCAAAGAGACGGAGTGAGG + Intronic
968633541 4:1665808-1665830 CTCCACAAAGAGATGAAGAATGG + Intronic
969225937 4:5798463-5798485 GTTGGAAAAGGGATGGAGAAAGG - Intronic
969616908 4:8258608-8258630 CTTTGCAAAGATAGGAAGAGAGG + Intergenic
969760900 4:9180939-9180961 TTTTCCAAAGAGACAGAGAATGG - Intergenic
972020936 4:34313196-34313218 CATGGCTAAGAGAGGGAGAAAGG + Intergenic
972090329 4:35273377-35273399 CCTTGCAGAGAGCCGGAGAAAGG - Intergenic
972473474 4:39429348-39429370 CTTTAGAAATAGATGAAGAAGGG - Intronic
972877238 4:43377719-43377741 CTTTGCAGGGACATGGATAAAGG + Intergenic
973625280 4:52765544-52765566 CATTGACAAGACATGGAGAATGG + Intergenic
974522421 4:63000278-63000300 GTTGGCAAAGATGTGGAGAAAGG + Intergenic
976157429 4:82161742-82161764 CTTTGAAAAGATATGTAAAATGG + Intergenic
976890047 4:90035566-90035588 CTTTGCAAGGACATGGATGAAGG + Intergenic
977385584 4:96335260-96335282 GTTGGCAAAGAGATGGAGAAAGG - Intergenic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978588507 4:110299004-110299026 CTTTGCATATAGATGTAGAAAGG + Intergenic
978635486 4:110800073-110800095 CAATGCAAAGAGATGAAGAGGGG + Intergenic
978806619 4:112807463-112807485 CTTTGAGGAGAGCTGGAGAATGG + Intergenic
978941579 4:114442683-114442705 CTGTGAAAAGAAATGAAGAAGGG + Intergenic
979344039 4:119564556-119564578 CTCTGCAAACAGAAGCAGAAGGG + Intronic
979543304 4:121911274-121911296 CTCTGCTAAGAAATGGAGATTGG - Intronic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
981053094 4:140331137-140331159 CTTATCAAAGAATTGGAGAAAGG - Intronic
981851404 4:149234401-149234423 CTTTGCAGGGACATGGACAAAGG - Intergenic
982092132 4:151889436-151889458 TTTTGCAACAAGATGCAGAATGG - Intergenic
982564303 4:156970024-156970046 GATTGCACAGAGCTGGAGAAAGG - Intronic
984126008 4:175811782-175811804 CCATGCAAAGATATGGATAATGG + Intronic
984686329 4:182672460-182672482 GTTGGCAGAGAGATAGAGAAGGG - Intronic
985256988 4:188080124-188080146 ATTAGCAAAGTGATGGTGAATGG - Intergenic
985597456 5:801713-801735 CTTTGCAGAGGGTTGGAGATCGG + Intronic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986829543 5:11560607-11560629 CTTCACAAAGTGTTGGAGAAGGG - Intronic
987341387 5:16942560-16942582 CTTTGGAGGGAGAAGGAGAAGGG - Intergenic
989508210 5:42252721-42252743 ATTTGCAATGACATGGATAAAGG - Intergenic
990044988 5:51418106-51418128 GTTGGCAAGGATATGGAGAAAGG + Intergenic
990540651 5:56769684-56769706 CATTGCAGAGATATAGAGAAAGG + Intergenic
991413292 5:66366422-66366444 GTTTTCAAAGAGAAGGAAAAGGG - Intergenic
992058555 5:73018813-73018835 CACTGCAAAGTGATGGAAAAGGG - Intronic
992795887 5:80255243-80255265 ATTTGCAAAGAGAGGCAGGAAGG + Intronic
993027996 5:82667885-82667907 CTTTGGAAAGAGAGGGATCAGGG - Intergenic
993059575 5:83023020-83023042 TTATTCAAAGAGATGAAGAATGG + Intergenic
993345811 5:86780757-86780779 ATTGGCAAGGATATGGAGAAAGG + Intergenic
993680543 5:90872760-90872782 CTCTGTAAAGGGGTGGAGAAGGG - Intronic
993806083 5:92411566-92411588 CTTTTCAAAGAGGCTGAGAAAGG + Intergenic
993963599 5:94332523-94332545 CTTTGCAGGGACATGGATAAAGG - Intronic
995127376 5:108591862-108591884 CTTTGCAGAAAGATGGGGAGTGG + Intergenic
996009552 5:118466394-118466416 CTTTGCATGGACATGGATAAGGG - Intergenic
999262614 5:150247071-150247093 CTTTGCAGAGAGAAGGGGAAGGG - Intronic
999416717 5:151404270-151404292 CAAAGTAAAGAGATGGAGAAAGG - Intergenic
1000631848 5:163599675-163599697 CAATGGAAAGAGATGGAGTATGG + Intergenic
1000802042 5:165739915-165739937 CATTGGAAAGAGAGGGAGATTGG + Intergenic
1002037755 5:176485892-176485914 CTTTTCAGAGAGATGGAGCTTGG + Intronic
1003219459 6:4145749-4145771 CTTCACGAAGAGATGGAGGATGG - Intergenic
1003859626 6:10310468-10310490 CTTTGAAATGTGATGGAAAAAGG - Intergenic
1004842327 6:19601333-19601355 GTTTGCAAAGAATTGGAAAATGG + Intergenic
1004959893 6:20775625-20775647 CTTTGGAAAGAAAAGGAGAGAGG - Intronic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006637676 6:35472211-35472233 CTTTGCAATCAGAAGGAAAAGGG + Intergenic
1007454650 6:41967168-41967190 CTTTGCTGAGTCATGGAGAACGG + Intronic
1008369895 6:50720220-50720242 GCTTTCAAAGGGATGGAGAAGGG - Intronic
1008437786 6:51496470-51496492 CCTTGCAGAGAACTGGAGAAGGG - Intergenic
1008887710 6:56449317-56449339 TTTTGCAAAGAAAAAGAGAAAGG - Intergenic
1009497328 6:64367490-64367512 TTTTGGAAAGAGAGGGAGGATGG + Intronic
1010464767 6:76154203-76154225 CTATGCAAAGACATGGGGTATGG + Intergenic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1011939468 6:92825278-92825300 TTTTCCATAGAGGTGGAGAAGGG + Intergenic
1011947142 6:92920066-92920088 TTTTGCAAAAACATGAAGAAAGG - Intergenic
1012591935 6:100992583-100992605 CTTTGCAGGGACATGGATAAAGG + Intergenic
1012835864 6:104266368-104266390 CTTTGGAAAAAAATGAAGAAGGG - Intergenic
1013813810 6:114073988-114074010 CTTTGCAGAGAGATGGATGAGGG + Intronic
1014357105 6:120426189-120426211 CCTTACAAAGCAATGGAGAAGGG + Intergenic
1015512569 6:134052833-134052855 CTTTGAAAAGAGGCAGAGAAAGG + Intergenic
1016205074 6:141458863-141458885 CTTTGCCGAGAGATAGATAAAGG - Intergenic
1016469754 6:144362662-144362684 CTTTGCCAAGACATGGAAAAAGG + Intronic
1016701520 6:147059496-147059518 CTTTGCAAAGAAATTGATTAAGG + Intergenic
1016704692 6:147093114-147093136 CATAGCAGAGAGATGGACAAAGG - Intergenic
1017742441 6:157418705-157418727 ATTTGCTGAGAGATGGGGAATGG - Intronic
1018251529 6:161876554-161876576 CTTTGAAATGCGAAGGAGAAAGG - Intronic
1018883357 6:167907552-167907574 CTTTGTAAAAACATAGAGAAAGG + Intronic
1019701348 7:2476278-2476300 CTCTGCACAGAGATGGGGTATGG - Intronic
1019948028 7:4345658-4345680 CTTAGCAAAGAGGTGAAGTAAGG - Intergenic
1020671848 7:11125291-11125313 CTTTGCAAAGGGATTGAGTGTGG - Intronic
1020803182 7:12756954-12756976 CTTCACGAAAAGATGGAGAAAGG - Intergenic
1021480100 7:21106253-21106275 CTCTTCAAAGAGTTGGGGAAAGG - Intergenic
1021779794 7:24092350-24092372 GTTGGCAAAGATGTGGAGAAAGG - Intergenic
1022008271 7:26287305-26287327 TTTTCCCAAGAGATGGAGGAAGG + Intergenic
1025153419 7:56579774-56579796 ATTGGCAAAGATGTGGAGAAAGG - Intergenic
1027552816 7:79620143-79620165 CTTTGCTATGAAATGGAGATGGG + Intergenic
1028061527 7:86323860-86323882 TTTTGCAAAGAAATTGTGAATGG + Intergenic
1030545977 7:110895540-110895562 CTTTGCACAGACATGGACAGGGG - Intronic
1030812911 7:113997449-113997471 GTTTACAAGGATATGGAGAAAGG + Intronic
1031713385 7:125076815-125076837 TTTTGAAAGGAGATGGAGAGAGG + Intergenic
1031834756 7:126669010-126669032 CTTTGCAGAGACATGGATGAAGG + Intronic
1032607257 7:133369283-133369305 CTTTAAAAAGAAAAGGAGAAAGG - Intronic
1033682626 7:143610243-143610265 ATTTGGAGAGAGATGGACAAAGG + Intergenic
1033702267 7:143851674-143851696 ATTTGGAGAGAGATGGACAAAGG - Exonic
1033963958 7:146950591-146950613 CTTTGCAGGGACATGGATAAAGG - Intronic
1036271007 8:7302768-7302790 TTTTCCAAAGAGACAGAGAATGG - Intergenic
1036350342 8:8007576-8007598 TTTTCCAAAGAGACAGAGAATGG + Intergenic
1036681072 8:10874703-10874725 CTTGGAAATGAGAAGGAGAAAGG - Intergenic
1036845611 8:12168001-12168023 CTTTCCAAAGAGACAGAGAATGG + Intergenic
1036866977 8:12410320-12410342 CTTTCCAAAGAGACAGAGAATGG + Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038237849 8:25778339-25778361 GCTAGCAAAGATATGGAGAAAGG - Intergenic
1038448887 8:27626155-27626177 CTTTGCAAAGAGAAGTAAATTGG + Intergenic
1039353979 8:36795053-36795075 CTTTGCAAGGAGATGGGGCAGGG + Intronic
1039687952 8:39827239-39827261 GTTGGCAAGGACATGGAGAAAGG + Intronic
1040883962 8:52239205-52239227 CTTTGGAAGGTGATAGAGAAGGG + Intronic
1041119425 8:54571199-54571221 GTTTACACAGAGATGGGGAATGG - Intergenic
1041683063 8:60612874-60612896 TTTTGGAATGAGATGGAGTAGGG - Intronic
1042069706 8:64917763-64917785 ATTTGCAAGGAGAAGGAGAAAGG - Intergenic
1043520996 8:81045053-81045075 CTTTGCTAGGAGATGTTGAATGG - Intronic
1043816210 8:84805151-84805173 GATTGAAAAGAAATGGAGAATGG - Intronic
1044758265 8:95489767-95489789 ATTTACAAAGAGATGGAAAATGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045722016 8:105123673-105123695 ATTTGCAAAGACATAAAGAAAGG - Intronic
1046301143 8:112292537-112292559 CTTTGCACATAGGTGGAGGATGG + Exonic
1046747212 8:117889065-117889087 CATAGCAAAGGAATGGAGAAGGG - Intronic
1047080385 8:121453376-121453398 CTTTTCAAAGAGACAGAGTAGGG + Intergenic
1047686300 8:127307962-127307984 GTTGGCAAAGAAATGGAGCATGG - Intergenic
1047938313 8:129803140-129803162 AGTGGCAAAGAGAAGGAGAAAGG - Intergenic
1048091530 8:131246287-131246309 CTTTGCTAGGAGAAAGAGAAAGG + Intergenic
1048225573 8:132582024-132582046 CTCTGCCAAGAGATGGGCAAGGG + Intronic
1048443024 8:134473922-134473944 CTCAGGAAAGAGATGCAGAATGG + Intergenic
1048729383 8:137420468-137420490 CTTGGAAAAGAGAGAGAGAAGGG - Intergenic
1049189215 8:141277352-141277374 CCTTGCTAAGTGATGGACAAAGG + Intronic
1050574126 9:6975017-6975039 CTATGCAAAAAGAAGGGGAATGG - Intronic
1050601093 9:7252267-7252289 CAATGAAAAGACATGGAGAAAGG - Intergenic
1050763911 9:9108974-9108996 CTTTGCAAAGAGTGGGGGAGAGG - Intronic
1050862011 9:10446820-10446842 CTTTGAAAAGAAATGCAAAAAGG + Intronic
1052391901 9:27889005-27889027 TTTTGGAAAGAGAAGAAGAAGGG + Intergenic
1052480578 9:29020208-29020230 CTTGGCAAAGAAATGTAGTATGG + Intergenic
1053271720 9:36754555-36754577 CTGGGCAATGAGATGGAGATAGG - Intergenic
1054734943 9:68741663-68741685 CTAAGCAAAGAGATAGAGAAGGG + Intronic
1055243599 9:74215609-74215631 CTTAACAAAGAGGTAGAGAAGGG - Intergenic
1055418654 9:76112121-76112143 CTTTGCAATTAGAAGCAGAAAGG - Intronic
1055891501 9:81128985-81129007 CTTTGCAGAGATATGGGAAATGG + Intergenic
1055917366 9:81418863-81418885 CTTTGCAAAAATTTGGATAAAGG - Intergenic
1056427252 9:86489618-86489640 TTTTGGAAGGAGATGGAGAAGGG - Intergenic
1058403952 9:104650369-104650391 ATATACACAGAGATGGAGAATGG + Intergenic
1060041749 9:120306473-120306495 CTATCCAAAGAGAAGGAGAAGGG - Intergenic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061251359 9:129428341-129428363 CCTTGCAGACTGATGGAGAAAGG + Intergenic
1186108326 X:6228829-6228851 CTGTGCTAAGAGACAGAGAAGGG + Exonic
1186143256 X:6599561-6599583 CTTTGAAATGAGATTTAGAATGG + Intergenic
1186337262 X:8603786-8603808 CTTTGCAAAGAGTCAGGGAATGG + Intronic
1186363965 X:8872496-8872518 CTTTGTGAAGAGAGGCAGAAGGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1188877700 X:35451451-35451473 ATTTGCAAGGATGTGGAGAAAGG - Intergenic
1188988857 X:36792498-36792520 GTTGGGAGAGAGATGGAGAAGGG - Intergenic
1191650315 X:63529821-63529843 CTTTGGAAAGAGAAAGAGAGTGG + Intergenic
1193505615 X:82338869-82338891 TTGTGGAAATAGATGGAGAAAGG - Intergenic
1193738454 X:85188089-85188111 ATTTGCAAAGAGATAATGAATGG - Intergenic
1194469996 X:94282309-94282331 CTATTCCAAAAGATGGAGAAAGG - Intergenic
1195676928 X:107513622-107513644 CTTTGCACAGAGATGTTGAGGGG + Intergenic
1195955909 X:110330275-110330297 CTTTGGAATGAAATGAAGAAGGG - Intronic
1196525098 X:116721932-116721954 CTTTGCCAAGAGATACATAAAGG + Intergenic
1197334985 X:125202822-125202844 CTTTGCCTAGAGGCGGAGAAGGG - Intergenic
1198081388 X:133243172-133243194 CTTTTTAAAGAGATGGAGCCAGG - Intergenic
1201540444 Y:15100203-15100225 CTTTGCCAAGAGATGCATAAGGG + Intergenic
1201723674 Y:17131876-17131898 CTTTGCTGAGAGATGAACAAAGG + Intergenic