ID: 978286156

View in Genome Browser
Species Human (GRCh38)
Location 4:107079509-107079531
Sequence TTGAATAAACAGAAGGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978286156_978286158 17 Left 978286156 4:107079509-107079531 CCACATTCCTTCTGTTTATTCAA 0: 1
1: 0
2: 1
3: 53
4: 474
Right 978286158 4:107079549-107079571 ACCTATCAAAGAACTTTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978286156 Original CRISPR TTGAATAAACAGAAGGAATG TGG (reversed) Intronic
901333947 1:8432316-8432338 TTGAATAAGCAGAAGTGAAGAGG - Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
901744497 1:11363537-11363559 TTTTATCAAAAGAAGGAATGAGG + Intergenic
902297439 1:15477673-15477695 TTGAGGAAACAGAAAGATTGGGG - Intronic
902497762 1:16886150-16886172 TTGAGGTAACAGAATGAATGAGG + Intronic
903107638 1:21097519-21097541 TTGAAAAACCAAAAGGAAGGGGG + Intronic
904203655 1:28838353-28838375 TTGAAGAAGCAGAAGGAACTTGG + Intronic
904362950 1:29990343-29990365 ATGAATAAACAATAGGAAAGTGG - Intergenic
905477622 1:38239903-38239925 TTGAACAAAAGGAAGAAATGAGG + Intergenic
905705003 1:40049094-40049116 TTGAATAGGCAGAAGGAATTGGG + Intronic
906617030 1:47240490-47240512 TGGAATAAAATGAATGAATGAGG - Intergenic
907214894 1:52854293-52854315 TTCAGTTAACAGTAGGAATGAGG + Intronic
907634165 1:56116832-56116854 GTGAAGAAACAGCAGGAAGGGGG + Intergenic
908375911 1:63540583-63540605 TTTAATAAACAGAAAAATTGAGG - Intronic
908603777 1:65770960-65770982 TTGAAGAAAGAGAAAGAAAGTGG - Intergenic
908818018 1:68053708-68053730 TTGAAATTACAGAAAGAATGGGG + Intergenic
909235300 1:73145672-73145694 TTTAAGAAACAGAAGCAATTTGG - Intergenic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909884103 1:80918954-80918976 TTGAATAGACAGTAAGAATGTGG + Intergenic
910328789 1:86044248-86044270 TATAATAAACAGAAAGAATAAGG + Intronic
910759730 1:90722519-90722541 GTGAATGAACAAAATGAATGAGG - Intergenic
910840672 1:91558254-91558276 TTAAATAAAAAGAATGAATAAGG - Intergenic
911072412 1:93842691-93842713 TTGATTCAAGATAAGGAATGTGG - Intronic
911666468 1:100558301-100558323 TGGAATAAGTATAAGGAATGTGG - Intergenic
912423433 1:109564405-109564427 GTGAGAAAACAGAATGAATGGGG - Intronic
913389625 1:118295926-118295948 TTGAATAGCCAGAAGAAATTTGG - Intergenic
914768544 1:150661955-150661977 TTGAATGAAGTGAAGGAATCAGG - Intronic
915235843 1:154481026-154481048 TGGAATAACTCGAAGGAATGAGG + Exonic
915506277 1:156358458-156358480 TTTAATAAACAGAGAGATTGAGG + Intronic
915734799 1:158077968-158077990 CTGCAGAAACAGAAAGAATGAGG - Intronic
916946206 1:169730367-169730389 ATCAAAAAACAGAAGCAATGAGG + Intronic
917039800 1:170792265-170792287 GTGAATAGAAAGAAGGAATAAGG + Intergenic
917531157 1:175836366-175836388 TTGAAGTTACAGAAAGAATGGGG + Intergenic
917859430 1:179132100-179132122 TTAAAAAAACAAAAGAAATGTGG + Intronic
918537835 1:185594101-185594123 CTGAATAAAAAGAAGGAATCAGG - Intergenic
919326979 1:196120463-196120485 CTGAACAAACAGAATGAAAGAGG + Intergenic
919546529 1:198927738-198927760 TTGAATAAAATAAAGGCATGAGG + Intergenic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
921137468 1:212274393-212274415 TTGAAAAACCAGAAGGAATTAGG - Intergenic
921554283 1:216578450-216578472 TTGGATAAACAGAGAGACTGTGG - Intronic
921757202 1:218872460-218872482 ATCAATAAACAAATGGAATGAGG + Intergenic
922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG + Intronic
923867959 1:237960809-237960831 TTGAAGTTACAGAAAGAATGGGG - Intergenic
924069951 1:240266365-240266387 TTCAATAAAAATAAGCAATGGGG - Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063242332 10:4183947-4183969 CTAAATAAACAGCAGAAATGTGG - Intergenic
1063943175 10:11151664-11151686 TTGAACTAAAAGGAGGAATGAGG + Intronic
1063969145 10:11369284-11369306 TTGAAGTTACAGAAGGAATGTGG - Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064283651 10:13972903-13972925 ATAAATAAACAAATGGAATGTGG - Intronic
1064444486 10:15381333-15381355 TTGAAGGACGAGAAGGAATGGGG - Intergenic
1064920250 10:20508942-20508964 TTGTATACACAGCAGGTATGTGG - Intergenic
1064923729 10:20547387-20547409 TTGAAATTAAAGAAGGAATGGGG + Intergenic
1065310598 10:24412715-24412737 ATGAATATAGAGAAGCAATGAGG - Intronic
1065794634 10:29294623-29294645 TTGAATAAATGGAGAGAATGAGG + Intronic
1065798122 10:29325743-29325765 TTGAATAAAGAAAAGGAAAGAGG + Intergenic
1066973980 10:42347102-42347124 TACAATAAACAAAAGCAATGTGG + Intergenic
1066996903 10:42572193-42572215 TTGAATACAGAGAAGAAACGTGG - Intergenic
1067082365 10:43218901-43218923 TTGAATTGACTGAAGGAATCTGG + Intronic
1068528420 10:58157620-58157642 TTGCATAACCAGAAGGAGTGTGG - Intergenic
1068658663 10:59601207-59601229 TTGAAAAAACAGCAGGGATTTGG + Intergenic
1069010499 10:63366579-63366601 CTGAATGAAGAGAAAGAATGAGG + Intronic
1069104281 10:64363843-64363865 TTGAGTACACAGAAGGAACAAGG + Intergenic
1069307238 10:66985703-66985725 ATAAACAAACAGAAAGAATGTGG - Intronic
1070039454 10:72760968-72760990 TAGAAGAAACAGAAGGTATCAGG - Intronic
1070122750 10:73594626-73594648 TTAAATAAACTGGAGGATTGGGG + Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070451966 10:76568177-76568199 TTGTATAAAAAGAAGGGATATGG - Intergenic
1070505664 10:77110806-77110828 TTGGATAAACTGATGGAAGGAGG - Intronic
1071128782 10:82368147-82368169 TTGAGTAAACACAGGGAATTTGG + Intronic
1071989928 10:91091808-91091830 TTCTATTAACAGAAGAAATGAGG - Intergenic
1072257619 10:93635368-93635390 TTAAATTAAAAGAAGGAATGGGG + Intronic
1072887090 10:99287308-99287330 GTGAAAGAAGAGAAGGAATGAGG + Intergenic
1072896978 10:99375829-99375851 TGGAAGAAGCAGAAGGATTGGGG + Intronic
1074863347 10:117530005-117530027 CTGAAAAAAAAGAAGGAATTAGG - Intergenic
1075502691 10:122990592-122990614 TTGAATAAAGAGAAGAAACTAGG + Intronic
1075971804 10:126661073-126661095 TTAGATACACAGAAAGAATGTGG - Intronic
1076434589 10:130431385-130431407 TTGAATTAAAAGAAAGAAAGAGG - Intergenic
1076766230 10:132635302-132635324 TTCAAAAGACAGCAGGAATGAGG - Intronic
1078614198 11:12849796-12849818 CTGAATAAATAGCAGGAATGAGG - Intronic
1079080668 11:17411600-17411622 TCAATTAAACAGAAGGAAAGAGG - Intronic
1079524758 11:21372343-21372365 CTGAATACACAGAATTAATGGGG + Intronic
1079825209 11:25182163-25182185 TTTAATAATCAGAAGGAAGCAGG + Intergenic
1080820817 11:35804761-35804783 TTGTATAACCAGCAGGAAAGGGG + Intronic
1081717037 11:45257763-45257785 TTGGACAAACAGAGGGGATGTGG + Intronic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083165002 11:60878765-60878787 TTGAATTAACATGGGGAATGAGG + Intergenic
1084104773 11:66974279-66974301 TTTAAGAAACAGAAGGAAACAGG - Intergenic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086776358 11:90838606-90838628 TTGAATCAACAGAAGGTATTTGG - Intergenic
1086811305 11:91313788-91313810 TTTCAAAAACAGAAGAAATGTGG + Intergenic
1087181475 11:95146376-95146398 TTGGAAAAAGAGGAGGAATGGGG - Intergenic
1087278825 11:96187390-96187412 ATGAATAAACAAAAGAATTGAGG + Intronic
1087714016 11:101585866-101585888 TTGAGTACCCAGAAGGAATAAGG + Intronic
1087729482 11:101761773-101761795 ATTAATAAACAAAAAGAATGGGG - Intronic
1087874098 11:103335213-103335235 TTGAAAAAAAAGAAGAAATGAGG + Intronic
1088072354 11:105804742-105804764 TTCCAAAAAGAGAAGGAATGTGG - Intronic
1088163166 11:106898943-106898965 TTGAAGAGACAGAAGGTATATGG + Intronic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1090904221 11:131060128-131060150 GTGAATAAAAAGGAGGAATATGG + Intergenic
1090942864 11:131403760-131403782 TTGAGAAAACAGAAGCAATCAGG + Intronic
1092577013 12:9796119-9796141 GTGGATAATCAGAAGGGATGTGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093102062 12:15039039-15039061 GTTAAGAAAGAGAAGGAATGGGG - Intergenic
1093126359 12:15333507-15333529 TTGAATAAATAAATGGAGTGAGG + Intronic
1093754040 12:22832643-22832665 TTGAATAAAGTGAGGGAATCAGG + Intergenic
1093855339 12:24094954-24094976 TTGGATAAACAAAAGGAGAGAGG - Intergenic
1094595352 12:31860760-31860782 TTTAAAAAACATCAGGAATGAGG + Intergenic
1095192529 12:39273868-39273890 TTGAAAAAATGGAATGAATGAGG + Intergenic
1095232519 12:39757868-39757890 TACAATAAAGAGAAGGATTGAGG + Exonic
1095533368 12:43217381-43217403 TTGAATAAAAAGAAATGATGGGG - Intergenic
1095545296 12:43360971-43360993 TTTAAAAAACAAAAGTAATGTGG - Intronic
1095662856 12:44757936-44757958 TTGAAAAAGCAGAAGGGATATGG + Intronic
1096209995 12:49757691-49757713 TGGAATTATCAGAAGGAAAGAGG + Intronic
1096591593 12:52663640-52663662 TTGCATACAGAGTAGGAATGTGG + Intergenic
1096929613 12:55192284-55192306 ATGAACAAAAAGAAGCAATGGGG - Intergenic
1096938678 12:55315415-55315437 GTTAATGAACTGAAGGAATGAGG + Intergenic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1098096600 12:66963480-66963502 ATGAAGAAAAAGAAGGAATAAGG + Intergenic
1098203066 12:68077743-68077765 TTGAAGAAACAGAGGCAAAGAGG - Intergenic
1099108880 12:78531508-78531530 TTGTAGAAACAGAAGCTATGAGG + Intergenic
1099369862 12:81815843-81815865 TCACATAAACAGAAGGAAAGAGG + Intergenic
1099816030 12:87648737-87648759 TTGATTTGACAGAAAGAATGTGG - Intergenic
1100291661 12:93220928-93220950 TTGAGGTTACAGAAGGAATGGGG - Intergenic
1100343525 12:93704481-93704503 TGGAATATACAGAAGGAAAGAGG - Intronic
1100631294 12:96391991-96392013 TTGAATAAAGTGATGGAATTAGG - Intronic
1100710557 12:97251600-97251622 TTTTAGAAACAGAAGGACTGAGG - Intergenic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1103117237 12:118346612-118346634 TTGAATAATTAGCAGAAATGTGG + Intronic
1103119432 12:118368861-118368883 TTAAATAAACAAAAGGGCTGAGG + Intronic
1105229600 13:18478791-18478813 TATAATAAACAAAAGCAATGTGG + Intergenic
1106430721 13:29677870-29677892 TTTTATAGACAGAAGAAATGAGG - Intergenic
1108489654 13:50968541-50968563 TTGGGTAAACAAAAGGAACGAGG - Intronic
1108866967 13:54936221-54936243 TTCAATAAAAAGAATCAATGAGG + Intergenic
1109041874 13:57348673-57348695 TTGAAGTTACAGAAAGAATGGGG - Intergenic
1109483160 13:62983718-62983740 TTTCATTAACAGAAGAAATGTGG - Intergenic
1109703991 13:66064473-66064495 TTGAATAAAATAAAGTAATGGGG - Intergenic
1109724569 13:66322582-66322604 TTAAATAAACAGAGGCAATGTGG - Intronic
1110448497 13:75615812-75615834 TTCACTAAAAAGAAGGAAGGAGG - Intergenic
1110998311 13:82142287-82142309 TTGTATAAACAGAAGTAAAGAGG - Intergenic
1111448642 13:88385015-88385037 TGGAATCATGAGAAGGAATGAGG + Intergenic
1111565585 13:90010624-90010646 TTGAATAAACAAACGGAATAGGG + Intergenic
1111868804 13:93804176-93804198 TTGAATAAAAAAAATGGATGAGG + Intronic
1112072022 13:95863643-95863665 ATGAAAAAACAAAAGGACTGTGG - Exonic
1112840831 13:103575739-103575761 TTGAATACACAGACTGAATTTGG - Intergenic
1113041841 13:106111976-106111998 TAGAAAAAAAAGAAAGAATGAGG - Intergenic
1113044950 13:106145888-106145910 TTGAAGTTACAGAATGAATGGGG - Intergenic
1113201786 13:107874473-107874495 GTGAATAAATAAAAGTAATGAGG + Intergenic
1113895189 13:113759692-113759714 TGGAATAAACGGAAGAGATGGGG - Intronic
1115552451 14:34516912-34516934 TTCAAAAAGCAGAAGGAAAGAGG - Intronic
1115793049 14:36901291-36901313 TTAAATAAACAAAAAGTATGAGG + Intronic
1118408277 14:65449434-65449456 TTGCCAAAACAGAAAGAATGCGG + Intronic
1119214080 14:72855279-72855301 TTTAAAAATCAGTAGGAATGAGG + Intronic
1119547389 14:75482313-75482335 GTGATTAAAAAGAAGAAATGGGG - Intergenic
1120698811 14:87675177-87675199 TTTAATAATCAGAAAGAGTGAGG - Intergenic
1120984548 14:90322446-90322468 TTGAATAAATAAAATGAATGAGG + Intronic
1121070481 14:91015936-91015958 TTGATTAAACAGTTAGAATGAGG - Intronic
1121430511 14:93883289-93883311 TTGACTATACTGAAGGAAAGTGG + Intergenic
1122000394 14:98646103-98646125 GTGAATGAGCAGAAGGTATGAGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122357624 14:101132921-101132943 TAGATCAAACAGAAGGAAAGGGG + Intergenic
1124814640 15:32977212-32977234 ATGAAGAAAGAGAAGCAATGAGG + Intronic
1125208444 15:37182322-37182344 GGGAATGAACAGAAGGGATGTGG + Intergenic
1125994886 15:44149120-44149142 ATCAACAACCAGAAGGAATGGGG + Intronic
1127107947 15:55637099-55637121 TTAAAGAAACAAAAGGAAAGGGG - Intronic
1127506203 15:59600279-59600301 TTGAGGTTACAGAAGGAATGGGG + Intronic
1128254905 15:66189343-66189365 TGTAATAAACATAACGAATGTGG + Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1129952130 15:79601254-79601276 TTGAAAACACAGAAGGTGTGAGG + Intergenic
1130235559 15:82130267-82130289 GTGAATAAACAGAGATAATGTGG + Exonic
1131218852 15:90563880-90563902 TTGAAAAAAAGGAAGGAAGGCGG - Intronic
1132147893 15:99439159-99439181 ATGAACAAACGGAAGAAATGAGG + Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1133895989 16:9929359-9929381 TTTACTAAACAGAAGAAATGAGG - Intronic
1134901968 16:17946477-17946499 TTAAATAAAGAGATGGACTGTGG + Intergenic
1135649273 16:24191573-24191595 TTGAACCAAGAGAAAGAATGAGG - Intronic
1137229346 16:46548819-46548841 TGGAATAAACAGAAGGCCAGTGG - Intergenic
1138637429 16:58352228-58352250 ATGAATAAACAGAAGCAATGAGG - Intronic
1138810330 16:60141471-60141493 TTGAAAAAAAAGAAGGATGGAGG + Intergenic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1141243474 16:82284833-82284855 ATGAAGAAACAGAAGAAATTAGG + Intergenic
1141472218 16:84246831-84246853 TGGAATAAACAGGAGGAAGGTGG + Intergenic
1141748663 16:85943566-85943588 TTGAGTAAAATGAATGAATGAGG + Intergenic
1141750770 16:85956428-85956450 ATGAATAAACAGAAGTATTCTGG - Intergenic
1143436283 17:6929590-6929612 GTTAATAACCAGAAGGTATGGGG + Intronic
1143988850 17:10939357-10939379 ATGAATAAACACGAGGCATGTGG - Intergenic
1145178135 17:20719775-20719797 TTAAATAAACAGAATGAACCTGG - Intergenic
1145358365 17:22184980-22185002 TGAATTAAACAGAAGAAATGAGG + Intergenic
1145980571 17:29008831-29008853 GTGAATAAACAACAGGGATGAGG + Intronic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146508466 17:33425657-33425679 TTGAGAAAACAGAAGGGATGGGG + Intronic
1146792162 17:35757673-35757695 TTGTATAGAGAAAAGGAATGGGG - Intronic
1146963839 17:37008206-37008228 TTCAATAAACAGAAATACTGTGG - Intronic
1147310781 17:39595148-39595170 GTGAATGAAGAGAAGGAATTGGG - Intergenic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1149680643 17:58504738-58504760 TGGGAAAACCAGAAGGAATGTGG - Intronic
1150081515 17:62243866-62243888 TTAAATAAACAGAATGAACCTGG + Intergenic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1150475752 17:65473323-65473345 CTGAAGAGAAAGAAGGAATGGGG - Intergenic
1151233042 17:72698639-72698661 ATGAATAAATAAAAGGAAAGTGG - Intronic
1151997014 17:77616227-77616249 TTGAATATACAGCAGAAATTGGG - Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153439541 18:5101403-5101425 TTGACTAAACTGAGGGAAGGGGG - Intergenic
1153749883 18:8218473-8218495 TTGAATAAGCAAGATGAATGGGG + Intronic
1154523799 18:15261043-15261065 TATAATAAACAAAAGCAATGTGG - Intergenic
1155150988 18:23122788-23122810 TGGAATAAACAGCAGGGTTGTGG + Intergenic
1155409916 18:25532593-25532615 GGTAATAAACAGAAGGAAGGAGG + Intergenic
1155567841 18:27156118-27156140 TTTAAGGAACAGTAGGAATGAGG + Intronic
1157678619 18:49586496-49586518 TTGGATAGACAGAAGGAAGCAGG + Intronic
1158557394 18:58486520-58486542 TTGAAAGAACAAAATGAATGGGG + Intronic
1158868524 18:61661436-61661458 TTGAAGTTACAGAAAGAATGGGG + Intergenic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159390072 18:67780619-67780641 TTGAAAAAAAAAAAGGAAAGGGG - Intergenic
1159742335 18:72187830-72187852 TGGAATGAACTGAAGGAATTAGG + Intergenic
1163946695 19:20543521-20543543 TTGTACAAATAGAAGGAATATGG - Exonic
1163948927 19:20566282-20566304 TTGAAAAAATAAAAAGAATGTGG - Intronic
1164844159 19:31417785-31417807 TTTGCTCAACAGAAGGAATGTGG - Intergenic
1164875674 19:31685093-31685115 TGGAATAAACAGAACAAATATGG - Intergenic
1164967090 19:32494762-32494784 GAGAAGAGACAGAAGGAATGTGG - Intergenic
1165116152 19:33530077-33530099 CTGAATATCCAGAAAGAATGGGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166420980 19:42635552-42635574 TGGAAGAATCAGAAGGAATGTGG + Intronic
1167251820 19:48402896-48402918 TTGAATAAAAAGGAGGATAGGGG + Intronic
924958532 2:11977-11999 TTGAATTTACAGAAGTGATGGGG - Intergenic
925878649 2:8332660-8332682 TGAAATAAACAAAAGGAGTGGGG + Intergenic
926490454 2:13519874-13519896 TTTTATAAACAGGAGAAATGAGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927171302 2:20372414-20372436 TTGAACTTACACAAGGAATGGGG - Intergenic
928320413 2:30278814-30278836 TTGAAGATACAGAAGAAAGGAGG - Intronic
928902911 2:36340229-36340251 GTGAATAAACAGAGCAAATGAGG + Intergenic
930392007 2:50773238-50773260 TTGAATAAATAGAATTAATGAGG - Intronic
930392384 2:50778543-50778565 TGGAATGAACAAAAGGAAGGTGG + Intronic
930881051 2:56271159-56271181 TTTACTAAACAGAAGTTATGAGG + Intronic
931663305 2:64590189-64590211 ATAAGAAAACAGAAGGAATGAGG - Intronic
932160605 2:69456104-69456126 TTGAATAAACAGGATAAATGGGG - Intergenic
935515710 2:104035924-104035946 ATGAATAAAAAGAATGATTGGGG + Intergenic
936969245 2:118161041-118161063 TTGAGGTTACAGAAGGAATGGGG + Intergenic
937998437 2:127713075-127713097 TTTAAGGAACAGAAGAAATGTGG - Intronic
938169192 2:129059715-129059737 TTGAATACAGTGAAAGAATGTGG + Intergenic
938523104 2:132093856-132093878 TATAATAAACAAAAGCAATGTGG - Intergenic
939050667 2:137303483-137303505 TTTAATAAACAGAATTAATGTGG + Intronic
939235221 2:139483238-139483260 TCCAATAGACAGAAGAAATGGGG - Intergenic
940068043 2:149651767-149651789 TAGAATAAAAAGAAAAAATGAGG - Intergenic
940504513 2:154535811-154535833 TTGAATAAAAAGAATGAAAAAGG + Intergenic
940778745 2:157910957-157910979 TTAAAGAAAGAGAAGGACTGTGG - Intronic
940973073 2:159914538-159914560 TTGAATGAACATAATAAATGAGG - Intergenic
941071287 2:160957247-160957269 TTGAATAGACTGATGGATTGGGG - Intergenic
941477753 2:165969280-165969302 ATGAATAAAGAGAAGAAATTTGG + Intergenic
941830738 2:169955897-169955919 TAGAATAAACACATGGACTGGGG - Intronic
941843192 2:170109417-170109439 TTGAAGAAACAGAAGGGCTGTGG - Intergenic
942344861 2:174992209-174992231 AAGAATAAACACAAAGAATGTGG + Intronic
942853807 2:180522584-180522606 TAGAACATGCAGAAGGAATGAGG - Intergenic
943022890 2:182596809-182596831 TTTAAAAAATAGAAGCAATGAGG + Intergenic
943026779 2:182638869-182638891 CTGAATAAACAGAAGCCATGTGG + Intergenic
943195895 2:184748850-184748872 TTCAACAAAAAGAAGCAATGAGG - Intronic
943475085 2:188344182-188344204 TTGATTAGAAAGAAGGAATGAGG + Intronic
943814006 2:192228206-192228228 TTGTAAAAACAGAAGAAATTTGG + Intergenic
943843349 2:192607120-192607142 AGAAATAAACAGAAGGAAAGAGG - Intergenic
943958668 2:194229840-194229862 TTGACTAGACAGAAGCAAAGGGG + Intergenic
944141932 2:196466215-196466237 TTGAATAAAGAGTTGGAAAGTGG + Intronic
944260509 2:197670900-197670922 TTGAAGGGACAGAAAGAATGAGG - Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944929175 2:204499165-204499187 GTGAATAAACTGAGGCAATGAGG - Intergenic
948155987 2:235781886-235781908 TTGATTCTACAAAAGGAATGCGG - Intronic
948302190 2:236915734-236915756 TTGGAGAAATAGAAGGAATTTGG + Intergenic
948315452 2:237025227-237025249 TGGCTTGAACAGAAGGAATGGGG + Intergenic
948638606 2:239358708-239358730 TTTAATAAAAACAAGGAAAGAGG - Intronic
1168978731 20:1987411-1987433 TTGAAAAAACAAAAGGCCTGGGG + Intronic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1170343613 20:15357774-15357796 ATGAATGAACAGTAAGAATGTGG - Intronic
1170902810 20:20482644-20482666 ATAAATAAACAGAAAGACTGTGG + Intronic
1171312984 20:24160587-24160609 TTGTATAAACAAAAGCAATGGGG + Intergenic
1173306509 20:41855745-41855767 TTGAATAAACAGAATAAGGGAGG + Intergenic
1174409246 20:50322844-50322866 TTGAATAGATAGAAGGCAGGAGG - Intergenic
1174502312 20:50994552-50994574 TGGGACAAACAGAAGGAACGTGG - Intergenic
1174653673 20:52152120-52152142 TTAAAAAAACAAAAGGAGTGGGG - Exonic
1174672744 20:52323231-52323253 GTGAATAAAGAGAAGAAAAGAGG + Intergenic
1174721764 20:52820331-52820353 CAGAAGAAACAGCAGGAATGGGG + Intergenic
1175558747 20:59898125-59898147 TTAAATAAAAAGAAAGAAAGTGG + Intronic
1176773589 21:13107150-13107172 TATAATAAACAAAAGCAATGTGG + Intergenic
1177161461 21:17552841-17552863 TTCTCTAAACAGAAGGAATGAGG - Intronic
1177236674 21:18399490-18399512 TAGAATACAAAGAAGGACTGAGG + Intronic
1177566001 21:22820744-22820766 TTGATTAAACAGAATAAATGAGG + Intergenic
1178079923 21:29052719-29052741 TTGAATAAATAGAAGACTTGTGG + Intronic
1179359866 21:40695602-40695624 TCGAATAAGGAGAAGGGATGGGG - Intronic
1179359925 21:40696281-40696303 TCGAATAAGGAGAAGGGATGGGG - Intronic
1180521203 22:16206846-16206868 TATAATAAACAAAAGCAATGTGG + Intergenic
1180782920 22:18530874-18530896 CCAAATAAACAGAAGGAAAGGGG - Intergenic
1181113444 22:20615904-20615926 CTGAATCAACAGAAGGCCTGTGG + Intergenic
1181239818 22:21470236-21470258 CCAAATAAACAGAAGGAAAGGGG - Intergenic
1181875611 22:25938192-25938214 TTGACTAGACATATGGAATGAGG - Intronic
1182131606 22:27857039-27857061 TAGACTAAAAATAAGGAATGAGG + Intronic
1182227306 22:28808987-28809009 TTAAACAAACAGAAGAAATGGGG - Intergenic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183104700 22:35607516-35607538 TGGAATAAAGAGAAGGTAGGAGG - Intronic
1183889778 22:40917410-40917432 TTTAAAAAACACAAGGAATAGGG + Intronic
1184295230 22:43519295-43519317 ATTAATAAACAAAAGGAATCAGG - Intergenic
1184300751 22:43558459-43558481 TTTTATAAACTGAAGGATTGTGG + Intronic
1184344318 22:43903662-43903684 TTTAATGAACAGAAGGAGTCCGG - Intergenic
950988854 3:17409122-17409144 TTTAATAAACTGAAGGTTTGTGG + Intronic
951612927 3:24511644-24511666 TTGTATATAAAGAAAGAATGGGG - Intergenic
951960481 3:28313322-28313344 ATCAATAAACAGTAGGAATGCGG - Intronic
952266189 3:31788852-31788874 TGGAAAATACAGAAGGCATGAGG + Intronic
953095600 3:39771912-39771934 AGGAATACACAGAAGGAGTGTGG + Intergenic
953401070 3:42618005-42618027 TTAAATAAATAGAAAAAATGGGG + Intronic
955552889 3:60103049-60103071 TTTATTAAAAAGAAGCAATGGGG - Intronic
955839910 3:63101156-63101178 CTGAATAAACAGAGACAATGCGG + Intergenic
957146456 3:76430451-76430473 TTAAAAAAACACAAGGATTGTGG - Intronic
957238747 3:77629832-77629854 TTCAATAAACAGTAGGCATATGG - Intronic
957848968 3:85780342-85780364 TTGATTCAACAGAAAGATTGAGG - Intronic
958645032 3:96859121-96859143 TTGAAGAAAATGAATGAATGAGG - Intronic
958686548 3:97405391-97405413 TCAAAGAAACAGAAGGTATGAGG - Intronic
958875565 3:99612646-99612668 TTCTAGAAACAGAAGAAATGGGG + Intergenic
958877836 3:99636316-99636338 TTGAATAAACAGCAATATTGAGG - Intergenic
959119024 3:102211114-102211136 TTTTATAAACAGAAGGAAGGTGG + Intronic
959822439 3:110752514-110752536 TTGAACTTACAGAAAGAATGGGG - Intergenic
959836791 3:110927382-110927404 TTGAAGAAAGAAAAGGAAGGAGG + Intergenic
959999452 3:112715384-112715406 TTGAATAAACAGACTGAGTAAGG + Intergenic
960478628 3:118161114-118161136 ATGAATAAACAGATAAAATGTGG + Intergenic
961492884 3:127267431-127267453 GTGACTAAAGAGAGGGAATGGGG + Intergenic
961639565 3:128356719-128356741 GTGGATACACAGAAGGAATCAGG - Intronic
964898874 3:161633016-161633038 TTTAATTCACAGAAGGCATGGGG + Intergenic
965548619 3:169940602-169940624 ATGAATAAAAAGAGGGAAAGAGG - Intergenic
965898614 3:173611036-173611058 TTGAATTAAAGGAAGGAACGTGG + Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
967550061 3:190782282-190782304 TTAAATTCACAGATGGAATGTGG - Intergenic
970380677 4:15504191-15504213 TTGCATAATTATAAGGAATGTGG + Intronic
970847724 4:20562288-20562310 GTGAAAAAATAAAAGGAATGAGG - Intronic
970979862 4:22083564-22083586 TTTAATAAACAGACAGAAAGGGG + Intergenic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971229541 4:24789890-24789912 TAGAGAAAACAGAGGGAATGCGG - Intronic
971676820 4:29642050-29642072 TTGAATAAACAGAATTGATGAGG + Intergenic
971836088 4:31764507-31764529 TTGAAGCAACAGATAGAATGTGG + Intergenic
972191098 4:36592135-36592157 TTGAATAAATAAAAGAACTGGGG + Intergenic
972915491 4:43872848-43872870 TTGAATAAAAAGACTAAATGAGG - Intergenic
973109804 4:46383763-46383785 TTAGATAAGCAGAAGGGATGAGG + Intronic
974166724 4:58213942-58213964 TTGAGAATACAGAAGGATTGGGG + Intergenic
974437221 4:61871385-61871407 TTGTGTAATCAAAAGGAATGAGG + Intronic
975704571 4:77099139-77099161 TTGCATAAAAAAATGGAATGTGG - Intergenic
975757224 4:77582867-77582889 TGAAATCAACAGAAGGAATGTGG + Intronic
977464680 4:97369005-97369027 TTCAACAATCAAAAGGAATGAGG - Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
979026541 4:115584537-115584559 ATGAATAAACAGAAGGCTAGTGG - Intergenic
979652791 4:123155446-123155468 TTGACTAGCAAGAAGGAATGTGG - Intronic
980488604 4:133494426-133494448 CTGAACAAACAGAAGTTATGTGG + Intergenic
981118910 4:141025539-141025561 ATGAAAAATGAGAAGGAATGGGG + Intronic
981292070 4:143087986-143088008 GTGAATAAATTGAACGAATGAGG - Intergenic
981599144 4:146465978-146466000 TAGAAAATACAGAAGGAAAGAGG - Intronic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982866824 4:160523780-160523802 TAGGATAAATTGAAGGAATGTGG - Intergenic
983205602 4:164907680-164907702 TTAAAAAAAAAGAAGGGATGGGG - Intergenic
983390847 4:167128051-167128073 TTGAAGAACAAGAAGGAAAGAGG - Intronic
984129258 4:175852643-175852665 TTTTAAAAACAAAAGGAATGGGG + Intronic
984859402 4:184223496-184223518 TTGAATAAAAAGAATGAAGCTGG + Intergenic
984938401 4:184909880-184909902 CTGAATGCAAAGAAGGAATGAGG - Intergenic
985341572 4:188960273-188960295 TGGAATAAAAAAAAGGAAGGAGG - Intergenic
986568476 5:9139872-9139894 TAGAAGAATCAGAAGGAATCGGG - Intronic
987395862 5:17422750-17422772 GTGAATAAAGAGAAGAATTGGGG - Intergenic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988354934 5:30161545-30161567 TTCCATTAACAGAAGTAATGTGG + Intergenic
988420341 5:30998356-30998378 TTGAATAAAGAGAGGCAATGTGG - Intergenic
989275151 5:39580268-39580290 TTGACTAGACAGCAGGAAAGGGG + Intergenic
989647143 5:43647265-43647287 TTAAAAAAACAAAAGAAATGAGG + Intronic
989764738 5:45068728-45068750 ATGAATAAAAAGAAGATATGTGG - Intergenic
990066440 5:51721130-51721152 TTGAAGGAGCAGCAGGAATGTGG + Intergenic
990693936 5:58393811-58393833 TTTTATAGACAAAAGGAATGTGG + Intergenic
990729354 5:58791359-58791381 GTGAATACACAGGAGAAATGTGG + Intronic
991034496 5:62114593-62114615 GAGGCTAAACAGAAGGAATGTGG - Intergenic
992127646 5:73658233-73658255 TAGAGTAAAGAGAAGAAATGGGG - Intronic
992534617 5:77686495-77686517 TGAAATAATCAGAAGCAATGAGG - Intergenic
993502204 5:88676688-88676710 TTAAATAAACAGAAGCAGGGAGG - Intergenic
993820764 5:92613510-92613532 TAGAATAAAAAGAATGAGTGGGG + Intergenic
994554591 5:101282434-101282456 CTGAATAAACAAAAAGGATGAGG - Intergenic
994784446 5:104138530-104138552 AGGAAAAAACAGAAGGAAAGAGG + Intergenic
995554849 5:113316999-113317021 TTGAATAACTAAAAGGAATCAGG - Intronic
996232032 5:121077461-121077483 TCACATTAACAGAAGGAATGTGG - Intergenic
996700040 5:126441574-126441596 CTAAATAAAGAGAAGGAATATGG - Intronic
996786741 5:127245334-127245356 CTGACAAAACACAAGGAATGGGG + Intergenic
996872260 5:128204359-128204381 GGGAGTAAACAGAAGAAATGGGG - Intergenic
997419950 5:133758382-133758404 AAGAATAAACATAAGGAAAGTGG + Intergenic
997529769 5:134574766-134574788 GTGAATAAACAGAAGATAGGGGG - Intronic
998082839 5:139291280-139291302 GTGAATAATCTGAGGGAATGAGG - Intronic
998610976 5:143687897-143687919 TGGAATACACAGAAGAATTGGGG - Intergenic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999814830 5:155165599-155165621 TGTAATAAAAAGATGGAATGGGG - Intergenic
1000666718 5:164006804-164006826 ATTTATAAACAGAAGGAAAGAGG + Intergenic
1000762743 5:165246259-165246281 ATAAATAAACAGGAGGAGTGTGG + Intergenic
1001739762 5:174042836-174042858 TTGATTATATAGAAGGAATAAGG + Intergenic
1002985047 6:2181498-2181520 TTTAATAAACTGAAGGCTTGTGG + Intronic
1003561274 6:7182724-7182746 TTGAACAGAAAGAAGGAAGGTGG + Intronic
1004184168 6:13407647-13407669 TTGAATCAAAAGCGGGAATGGGG + Intronic
1005183715 6:23137725-23137747 AGGAATATGCAGAAGGAATGTGG + Intergenic
1006730406 6:36231752-36231774 TTGAAGAGAAAGAAGGAAGGAGG - Exonic
1006900925 6:37500470-37500492 AGGAATAAACAGAAGCAAAGAGG - Intergenic
1007977031 6:46112455-46112477 TTGAAGATGCAGAAAGAATGGGG - Intergenic
1008085025 6:47235390-47235412 TTTAATAAAAAGAAGCGATGAGG + Intronic
1009227494 6:61032488-61032510 TATAATAATCAGAAGGAAAGAGG - Intergenic
1009247158 6:61252645-61252667 TAGAAAAAACAAAAGAAATGAGG + Intergenic
1009439346 6:63657979-63658001 TTGAATGAACTGAAGGAAATAGG - Intronic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1009937080 6:70246532-70246554 CTAAATAAAGATAAGGAATGGGG - Intronic
1010331933 6:74633460-74633482 TTAAATAAAAAGAAGGAACATGG - Intergenic
1010735557 6:79440087-79440109 TTGAATAAACACAATAACTGAGG - Intergenic
1011206826 6:84907940-84907962 TTGAATACACTTAAGGAATTTGG - Intergenic
1011968715 6:93194553-93194575 TTGAATATTAAGAAGGAATTTGG + Intergenic
1012438720 6:99242031-99242053 TTGACTAAACAGAAGCTCTGTGG + Intergenic
1012701983 6:102469812-102469834 TTGGATAAATACAAGGAGTGTGG + Intergenic
1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG + Intergenic
1013087311 6:106867356-106867378 TTGAAGTTACAGAAAGAATGGGG + Intergenic
1013164265 6:107575563-107575585 TGGAACAAACAGAAGGGGTGGGG + Intronic
1013190376 6:107799985-107800007 TTGAATCCACAGTGGGAATGTGG + Intronic
1014313612 6:119835967-119835989 TTGACAAAAGAGAAGGACTGGGG - Intergenic
1014786785 6:125628499-125628521 TTGAATAAACTGAAAGACTAGGG + Intergenic
1015878083 6:137844451-137844473 TTGAAGAAAGAGGAGGAGTGTGG + Intergenic
1016317704 6:142808506-142808528 ATGAATAGACAGAGGGAAGGAGG + Intronic
1016402328 6:143694071-143694093 TTAAAGAAAAAGAAGGAAGGAGG + Intronic
1016869652 6:148804074-148804096 GTGAATAAATAAAAGAAATGAGG + Intronic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1018465745 6:164043153-164043175 TTGGATAAACAAAAAGAATAAGG - Intergenic
1020248885 7:6451363-6451385 TTCATTAAGCAGAAAGAATGTGG + Intronic
1020471618 7:8542891-8542913 TTGGATAAATGGAAGGAATTAGG + Intronic
1020793148 7:12651134-12651156 TTGAAGTTACAGAAAGAATGGGG + Intronic
1020866877 7:13575535-13575557 TTGAGTAAACCAAAGGAAAGGGG - Intergenic
1021360176 7:19703301-19703323 TGCAATAAAGAGAAGGAATTGGG + Intronic
1021454354 7:20813280-20813302 TTGTATAAACAGGAGGAATATGG + Intergenic
1022334627 7:29410966-29410988 TTTAATAAAAAGTAGAAATGGGG - Intronic
1022373787 7:29794403-29794425 TTAAATCAAAAGAAGGAAAGGGG + Intergenic
1022574093 7:31481090-31481112 TGGTGTAGACAGAAGGAATGGGG - Intergenic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023436896 7:40148724-40148746 TTGAAGTTACAGAAAGAATGGGG + Intronic
1023672725 7:42595471-42595493 TTAATTAAACAGAAGGAATCAGG + Intergenic
1024762226 7:52612435-52612457 TTGTATAAGAAGAGGGAATGAGG - Intergenic
1024805859 7:53138917-53138939 TTGAGTTTACAGAAAGAATGGGG - Intergenic
1024867460 7:53920200-53920222 TTAATTAAACAGGAAGAATGAGG - Intergenic
1025792990 7:64709693-64709715 TTGTACAAATACAAGGAATGTGG + Exonic
1027848384 7:83416020-83416042 TTGAAAAAGCAGCAGGAATGTGG - Intronic
1028018263 7:85741534-85741556 TTGAAAAAACAGAATCAAAGAGG - Intergenic
1028532904 7:91858389-91858411 TTGAATAAATGGAAACAATGTGG + Intronic
1028883153 7:95902828-95902850 TTTAATAAATTGAGGGAATGTGG - Intronic
1030267626 7:107636624-107636646 TTTAATAAACAGATTGACTGAGG - Intergenic
1030399477 7:109030515-109030537 TTAAAAAAAAAGAAAGAATGTGG - Intergenic
1030715769 7:112805154-112805176 TTGGATAAGCAGGAGGAAAGGGG - Intergenic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1030724220 7:112906397-112906419 CTGTATAAACAGAAGGGAAGGGG + Intronic
1031132725 7:117851337-117851359 TTGAATAGACAGAAGAGATTGGG - Intronic
1031780454 7:125955365-125955387 TTTAATAAAAATAAGCAATGGGG + Intergenic
1031803987 7:126285310-126285332 TTTAATGAAGAGAAGAAATGTGG + Intergenic
1032424148 7:131806923-131806945 TTGACTAAACACTTGGAATGTGG - Intergenic
1032746765 7:134793918-134793940 TAGAGTAAAGTGAAGGAATGAGG - Intronic
1032930033 7:136655636-136655658 TTGACTGAACAGAGGAAATGAGG - Intergenic
1034071868 7:148193910-148193932 TTGAACAAGCAGAAGGAAACGGG - Intronic
1034524525 7:151648852-151648874 TTTAAAAAACAGAAAGAAAGGGG + Intronic
1035835339 8:2744558-2744580 TTGAAAAAAAAGATGGAATGTGG + Intergenic
1035876173 8:3191873-3191895 ATGAAGAAACACAAGGACTGAGG - Intronic
1036078977 8:5532228-5532250 GTGAACAAACAGAAGAAATGAGG - Intergenic
1036126608 8:6068666-6068688 GTGATGAAAAAGAAGGAATGAGG - Intergenic
1036540175 8:9700010-9700032 TTGGATAAACAGAATCACTGAGG - Intronic
1036615787 8:10386351-10386373 TTGAAAACACCTAAGGAATGGGG + Intronic
1037266243 8:17063982-17064004 GTGAATAAACAGAGTAAATGAGG - Intronic
1037412910 8:18616960-18616982 TTGAAGTTACAGAAAGAATGGGG - Intronic
1037750538 8:21679257-21679279 AAGAATAGACAGAAAGAATGAGG - Intergenic
1039042960 8:33425461-33425483 TGGAATAAACAGAAAAAAGGAGG + Intronic
1039190287 8:34965961-34965983 ATGACTAAAAAGAAGGACTGTGG - Intergenic
1040918122 8:52584849-52584871 TTGAATAAATATAAGGAAGTAGG - Intergenic
1043262694 8:78221551-78221573 GTAAAGAAAAAGAAGGAATGTGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044912693 8:97077968-97077990 GTAAATAAAGAGAAAGAATGAGG - Intronic
1045815979 8:106276665-106276687 TTAAATAAACAGAAGAAACATGG - Intronic
1046331944 8:112728650-112728672 TTGAAGTTACAGAAAGAATGGGG - Intronic
1046847949 8:118939645-118939667 ATGAAGAAAGAGAAGGAATTTGG + Intronic
1046976205 8:120280874-120280896 AAGAATAAACATAAGGAATATGG - Intronic
1046997924 8:120544984-120545006 TTGCATAAACAGAGGAAATTTGG + Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1048245165 8:132788244-132788266 TTGAATAAATGAAATGAATGAGG + Intronic
1048952666 8:139509217-139509239 TTGAGGACACAGAAGGAATAGGG + Intergenic
1049314517 8:141955552-141955574 TTGAATAAACTGAAGTATAGAGG + Intergenic
1050840238 9:10139766-10139788 GTGAACAAAAATAAGGAATGGGG + Intronic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1052072244 9:24095503-24095525 TTGTATATACAGGAGGAATTTGG + Intergenic
1052361118 9:27559383-27559405 TTGAGGTAACAGAAGGAATAAGG + Intronic
1053701795 9:40701085-40701107 TATAATAAACAAAAGTAATGTGG - Intergenic
1054411858 9:64824540-64824562 TATAATAAACAAAAGCAATGTGG - Intergenic
1055529094 9:77165724-77165746 TTGAATAAACAAATCGGATGAGG - Intergenic
1056803450 9:89710229-89710251 TTGAATGAAAAGAATAAATGAGG - Intergenic
1056902716 9:90614743-90614765 TTTAAGAAACATAAGGAATCAGG + Intronic
1057315956 9:93968646-93968668 CTAAATAAACTGAACGAATGAGG + Intergenic
1057850194 9:98559948-98559970 TTGCATAAAAAGAAGAAATGAGG + Intronic
1058318947 9:103606005-103606027 CTGGAGAAACTGAAGGAATGGGG - Intergenic
1058640686 9:107081058-107081080 CTGATTAAGCAGAAGGAAAGAGG + Intergenic
1059529767 9:115025169-115025191 TTCATTAAGCAGCAGGAATGTGG - Intronic
1059692233 9:116697016-116697038 TTGAAAGAAATGAAGGAATGAGG - Intronic
1060056496 9:120418447-120418469 TTGAGGAACCAGAAGGAAAGTGG - Intronic
1060753885 9:126195000-126195022 TTGAAAAAAGAGAGGTAATGAGG - Intergenic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1061354443 9:130093807-130093829 TTGAAAAAAAAAAAGAAATGGGG - Intronic
1186013432 X:5163997-5164019 TTGAGTTTACAGAAAGAATGGGG - Intergenic
1186042974 X:5502214-5502236 TTGAATAAAATGTAGAAATGCGG + Intergenic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1186330566 X:8527624-8527646 TTGAAGTTACAGAAAGAATGGGG - Intergenic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1186908082 X:14132722-14132744 TTGAAGAAACAGAACGATTCTGG - Intergenic
1186994265 X:15102998-15103020 ATGTATATCCAGAAGGAATGGGG - Intergenic
1187176955 X:16904582-16904604 ATCAATAAACAGAAGGTTTGTGG + Intergenic
1189244557 X:39553533-39553555 TTGAATGAACGGAAAGACTGTGG - Intergenic
1189560921 X:42190832-42190854 GTGAATTAACAGAATGAATAGGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1191707366 X:64107797-64107819 CTGGATAAACACATGGAATGTGG - Intergenic
1191768301 X:64726588-64726610 TGGAATAAACTGTAGGACTGGGG - Intergenic
1193039135 X:76986458-76986480 TTGAAAAAATATAAGGAAGGGGG - Intergenic
1193173619 X:78365987-78366009 TTGAGAAAACTGAAGGAAAGAGG + Intergenic
1193373954 X:80735299-80735321 TAGAAAAAACAAAAGGAACGTGG + Intronic
1193925715 X:87481349-87481371 TTGAATAATCAGAGGAAAAGTGG + Intergenic
1194371752 X:93082536-93082558 TTGAAGTTACAGAAAGAATGGGG - Intergenic
1194669294 X:96710491-96710513 TAGAATCACCAGAAAGAATGTGG - Intronic
1194707205 X:97190184-97190206 TTGTACAAACACAAAGAATGGGG - Intronic
1194753609 X:97711404-97711426 TTGAAAAAAAAAAAGGAATGGGG + Intergenic
1194802442 X:98289757-98289779 TTGAAGTTACAGAAAGAATGGGG + Intergenic
1195424105 X:104708351-104708373 ATTAATAAATAGAAGGCATGAGG - Intronic
1195844807 X:109214760-109214782 TTGAATAACCATTAGGAAAGTGG - Intergenic
1198068408 X:133123063-133123085 TTGAAATTACAGAAAGAATGGGG + Intergenic
1198434303 X:136600442-136600464 TTGAAGAAATAGAATGAGTGGGG - Intergenic
1200679794 Y:6196585-6196607 TTGAAGTTACAGAAAGAATGGGG - Intergenic
1200833972 Y:7714625-7714647 ATGAGGAAACAGCAGGAATGTGG + Intergenic
1201147286 Y:11072259-11072281 TTAAATGAACAGAAGGAAGCCGG - Intergenic
1201496324 Y:14594223-14594245 ATGATCCAACAGAAGGAATGAGG - Intronic
1201691607 Y:16772656-16772678 TTGAATAAACAGAATGAAATAGG - Intergenic
1201738842 Y:17302125-17302147 TTGAGGTTACAGAAGGAATGGGG + Intergenic