ID: 978310653

View in Genome Browser
Species Human (GRCh38)
Location 4:107381958-107381980
Sequence GTCCCAATGGGGGTCTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978310653_978310659 -1 Left 978310653 4:107381958-107381980 CCACTCAAGACCCCCATTGGGAC No data
Right 978310659 4:107381980-107382002 CAGTAACAATGCAAATCACTGGG No data
978310653_978310658 -2 Left 978310653 4:107381958-107381980 CCACTCAAGACCCCCATTGGGAC No data
Right 978310658 4:107381979-107382001 ACAGTAACAATGCAAATCACTGG No data
978310653_978310662 20 Left 978310653 4:107381958-107381980 CCACTCAAGACCCCCATTGGGAC No data
Right 978310662 4:107382001-107382023 GGAAAATATGCAGGACCTAAGGG No data
978310653_978310660 11 Left 978310653 4:107381958-107381980 CCACTCAAGACCCCCATTGGGAC No data
Right 978310660 4:107381992-107382014 AAATCACTGGGAAAATATGCAGG No data
978310653_978310661 19 Left 978310653 4:107381958-107381980 CCACTCAAGACCCCCATTGGGAC No data
Right 978310661 4:107382000-107382022 GGGAAAATATGCAGGACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978310653 Original CRISPR GTCCCAATGGGGGTCTTGAG TGG (reversed) Intergenic
No off target data available for this crispr