ID: 978312230

View in Genome Browser
Species Human (GRCh38)
Location 4:107397069-107397091
Sequence TTGTAGGTCTAGAATTAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978312230_978312236 27 Left 978312230 4:107397069-107397091 CCCCTTTAATTCTAGACCTACAA No data
Right 978312236 4:107397119-107397141 GCAATGCATGACCCATGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978312230 Original CRISPR TTGTAGGTCTAGAATTAAAG GGG (reversed) Intergenic
No off target data available for this crispr