ID: 978313698

View in Genome Browser
Species Human (GRCh38)
Location 4:107413792-107413814
Sequence CTCTGTGCACAGATCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978313694_978313698 12 Left 978313694 4:107413757-107413779 CCTAGCTTAAAGGATCCTCACAC No data
Right 978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG No data
978313693_978313698 19 Left 978313693 4:107413750-107413772 CCAGCAACCTAGCTTAAAGGATC 0: 26
1: 21
2: 5
3: 15
4: 52
Right 978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG No data
978313696_978313698 -3 Left 978313696 4:107413772-107413794 CCTCACACACTTGGTGACAACTC No data
Right 978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978313698 Original CRISPR CTCTGTGCACAGATCAAGGA AGG Intergenic
No off target data available for this crispr