ID: 978315592

View in Genome Browser
Species Human (GRCh38)
Location 4:107433040-107433062
Sequence ATGCGGTTGAGAAATAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978315592_978315593 -8 Left 978315592 4:107433040-107433062 CCATCATTATTTCTCAACCGCAT No data
Right 978315593 4:107433055-107433077 AACCGCATCCTCCTCTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978315592 Original CRISPR ATGCGGTTGAGAAATAATGA TGG (reversed) Intergenic
No off target data available for this crispr