ID: 978315593

View in Genome Browser
Species Human (GRCh38)
Location 4:107433055-107433077
Sequence AACCGCATCCTCCTCTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978315591_978315593 4 Left 978315591 4:107433028-107433050 CCTAGGTCTGAGCCATCATTATT No data
Right 978315593 4:107433055-107433077 AACCGCATCCTCCTCTTAACAGG No data
978315592_978315593 -8 Left 978315592 4:107433040-107433062 CCATCATTATTTCTCAACCGCAT No data
Right 978315593 4:107433055-107433077 AACCGCATCCTCCTCTTAACAGG No data
978315590_978315593 14 Left 978315590 4:107433018-107433040 CCACTGGCTACCTAGGTCTGAGC No data
Right 978315593 4:107433055-107433077 AACCGCATCCTCCTCTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978315593 Original CRISPR AACCGCATCCTCCTCTTAAC AGG Intergenic
No off target data available for this crispr