ID: 978315962

View in Genome Browser
Species Human (GRCh38)
Location 4:107437526-107437548
Sequence AAACACTGTTTCACAACGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978315960_978315962 19 Left 978315960 4:107437484-107437506 CCAGTTTGCTCCTTAATTTTGTT No data
Right 978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG No data
978315961_978315962 9 Left 978315961 4:107437494-107437516 CCTTAATTTTGTTTTCGTTGCTG No data
Right 978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978315962 Original CRISPR AAACACTGTTTCACAACGAT AGG Intergenic
No off target data available for this crispr