ID: 978325794

View in Genome Browser
Species Human (GRCh38)
Location 4:107552703-107552725
Sequence GGGGCTGCTGCCAGTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978325793_978325794 -6 Left 978325793 4:107552686-107552708 CCTAACTAAGGAGAGCAGGGGCT No data
Right 978325794 4:107552703-107552725 GGGGCTGCTGCCAGTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978325794 Original CRISPR GGGGCTGCTGCCAGTTTTCC AGG Intergenic
No off target data available for this crispr