ID: 978328874

View in Genome Browser
Species Human (GRCh38)
Location 4:107590013-107590035
Sequence TACATAAGAATAAGAAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328874_978328876 -6 Left 978328874 4:107590013-107590035 CCTTACCTTCTTATTCTTATGTA No data
Right 978328876 4:107590030-107590052 TATGTAAATATTCCTCCACCAGG No data
978328874_978328884 26 Left 978328874 4:107590013-107590035 CCTTACCTTCTTATTCTTATGTA No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data
978328874_978328883 16 Left 978328874 4:107590013-107590035 CCTTACCTTCTTATTCTTATGTA No data
Right 978328883 4:107590052-107590074 GGAGAAAAGCTTAATTGCTGGGG No data
978328874_978328882 15 Left 978328874 4:107590013-107590035 CCTTACCTTCTTATTCTTATGTA No data
Right 978328882 4:107590051-107590073 GGGAGAAAAGCTTAATTGCTGGG No data
978328874_978328881 14 Left 978328874 4:107590013-107590035 CCTTACCTTCTTATTCTTATGTA No data
Right 978328881 4:107590050-107590072 AGGGAGAAAAGCTTAATTGCTGG No data
978328874_978328877 -5 Left 978328874 4:107590013-107590035 CCTTACCTTCTTATTCTTATGTA No data
Right 978328877 4:107590031-107590053 ATGTAAATATTCCTCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328874 Original CRISPR TACATAAGAATAAGAAGGTA AGG (reversed) Intergenic