ID: 978328875

View in Genome Browser
Species Human (GRCh38)
Location 4:107590018-107590040
Sequence ATATTTACATAAGAATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328875_978328885 30 Left 978328875 4:107590018-107590040 CCTTCTTATTCTTATGTAAATAT No data
Right 978328885 4:107590071-107590093 GGGGACAAAGCTGGACTCCCTGG No data
978328875_978328877 -10 Left 978328875 4:107590018-107590040 CCTTCTTATTCTTATGTAAATAT No data
Right 978328877 4:107590031-107590053 ATGTAAATATTCCTCCACCAGGG No data
978328875_978328882 10 Left 978328875 4:107590018-107590040 CCTTCTTATTCTTATGTAAATAT No data
Right 978328882 4:107590051-107590073 GGGAGAAAAGCTTAATTGCTGGG No data
978328875_978328883 11 Left 978328875 4:107590018-107590040 CCTTCTTATTCTTATGTAAATAT No data
Right 978328883 4:107590052-107590074 GGAGAAAAGCTTAATTGCTGGGG No data
978328875_978328884 21 Left 978328875 4:107590018-107590040 CCTTCTTATTCTTATGTAAATAT No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data
978328875_978328881 9 Left 978328875 4:107590018-107590040 CCTTCTTATTCTTATGTAAATAT No data
Right 978328881 4:107590050-107590072 AGGGAGAAAAGCTTAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328875 Original CRISPR ATATTTACATAAGAATAAGA AGG (reversed) Intergenic