ID: 978328879

View in Genome Browser
Species Human (GRCh38)
Location 4:107590045-107590067
Sequence AATTAAGCTTTTCTCCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328879_978328888 15 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328888 4:107590083-107590105 GGACTCCCTGGCCAAGGACTGGG No data
978328879_978328892 26 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328892 4:107590094-107590116 CCAAGGACTGGGAGACTCCCTGG No data
978328879_978328884 -6 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data
978328879_978328885 3 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328885 4:107590071-107590093 GGGGACAAAGCTGGACTCCCTGG No data
978328879_978328886 9 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328886 4:107590077-107590099 AAAGCTGGACTCCCTGGCCAAGG No data
978328879_978328887 14 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328887 4:107590082-107590104 TGGACTCCCTGGCCAAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328879 Original CRISPR AATTAAGCTTTTCTCCCTGG TGG (reversed) Intergenic