ID: 978328880

View in Genome Browser
Species Human (GRCh38)
Location 4:107590048-107590070
Sequence AGCAATTAAGCTTTTCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328880_978328887 11 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328887 4:107590082-107590104 TGGACTCCCTGGCCAAGGACTGG 0: 1
1: 0
2: 3
3: 19
4: 200
978328880_978328893 29 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328893 4:107590100-107590122 ACTGGGAGACTCCCTGGCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 231
978328880_978328892 23 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328892 4:107590094-107590116 CCAAGGACTGGGAGACTCCCTGG No data
978328880_978328885 0 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328885 4:107590071-107590093 GGGGACAAAGCTGGACTCCCTGG No data
978328880_978328888 12 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328888 4:107590083-107590105 GGACTCCCTGGCCAAGGACTGGG No data
978328880_978328884 -9 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data
978328880_978328886 6 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328886 4:107590077-107590099 AAAGCTGGACTCCCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328880 Original CRISPR AGCAATTAAGCTTTTCTCCC TGG (reversed) Intergenic
No off target data available for this crispr