ID: 978328884

View in Genome Browser
Species Human (GRCh38)
Location 4:107590062-107590084
Sequence TTAATTGCTGGGGACAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328875_978328884 21 Left 978328875 4:107590018-107590040 CCTTCTTATTCTTATGTAAATAT No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data
978328874_978328884 26 Left 978328874 4:107590013-107590035 CCTTACCTTCTTATTCTTATGTA No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data
978328878_978328884 -3 Left 978328878 4:107590042-107590064 CCTCCACCAGGGAGAAAAGCTTA No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data
978328879_978328884 -6 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data
978328880_978328884 -9 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328884 4:107590062-107590084 TTAATTGCTGGGGACAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328884 Original CRISPR TTAATTGCTGGGGACAAAGC TGG Intergenic