ID: 978328885

View in Genome Browser
Species Human (GRCh38)
Location 4:107590071-107590093
Sequence GGGGACAAAGCTGGACTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328880_978328885 0 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328885 4:107590071-107590093 GGGGACAAAGCTGGACTCCCTGG No data
978328878_978328885 6 Left 978328878 4:107590042-107590064 CCTCCACCAGGGAGAAAAGCTTA No data
Right 978328885 4:107590071-107590093 GGGGACAAAGCTGGACTCCCTGG No data
978328875_978328885 30 Left 978328875 4:107590018-107590040 CCTTCTTATTCTTATGTAAATAT No data
Right 978328885 4:107590071-107590093 GGGGACAAAGCTGGACTCCCTGG No data
978328879_978328885 3 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328885 4:107590071-107590093 GGGGACAAAGCTGGACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328885 Original CRISPR GGGGACAAAGCTGGACTCCC TGG Intergenic