ID: 978328886

View in Genome Browser
Species Human (GRCh38)
Location 4:107590077-107590099
Sequence AAAGCTGGACTCCCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328879_978328886 9 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328886 4:107590077-107590099 AAAGCTGGACTCCCTGGCCAAGG No data
978328878_978328886 12 Left 978328878 4:107590042-107590064 CCTCCACCAGGGAGAAAAGCTTA No data
Right 978328886 4:107590077-107590099 AAAGCTGGACTCCCTGGCCAAGG No data
978328880_978328886 6 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328886 4:107590077-107590099 AAAGCTGGACTCCCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328886 Original CRISPR AAAGCTGGACTCCCTGGCCA AGG Intergenic