ID: 978328888

View in Genome Browser
Species Human (GRCh38)
Location 4:107590083-107590105
Sequence GGACTCCCTGGCCAAGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328880_978328888 12 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328888 4:107590083-107590105 GGACTCCCTGGCCAAGGACTGGG No data
978328879_978328888 15 Left 978328879 4:107590045-107590067 CCACCAGGGAGAAAAGCTTAATT No data
Right 978328888 4:107590083-107590105 GGACTCCCTGGCCAAGGACTGGG No data
978328878_978328888 18 Left 978328878 4:107590042-107590064 CCTCCACCAGGGAGAAAAGCTTA No data
Right 978328888 4:107590083-107590105 GGACTCCCTGGCCAAGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328888 Original CRISPR GGACTCCCTGGCCAAGGACT GGG Intergenic