ID: 978328893

View in Genome Browser
Species Human (GRCh38)
Location 4:107590100-107590122
Sequence ACTGGGAGACTCCCTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978328880_978328893 29 Left 978328880 4:107590048-107590070 CCAGGGAGAAAAGCTTAATTGCT No data
Right 978328893 4:107590100-107590122 ACTGGGAGACTCCCTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978328893 Original CRISPR ACTGGGAGACTCCCTGGCCA AGG Intergenic