ID: 978334219

View in Genome Browser
Species Human (GRCh38)
Location 4:107648483-107648505
Sequence TGGGATGTGAAGCACAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978334219 Original CRISPR TGGGATGTGAAGCACAGTTC TGG (reversed) Intronic
903787063 1:25868356-25868378 TGGGATATGGAGCACAGGACTGG - Intronic
905548309 1:38817293-38817315 CAGAATCTGAAGCACAGTTCAGG + Intergenic
909328909 1:74388881-74388903 TGGGAAGTCCAGCACAGTACAGG + Intronic
916470208 1:165116480-165116502 GGGCATGTGAAACACAGTTTGGG - Intergenic
917296127 1:173521116-173521138 TAGAATGGGAAGCACATTTCAGG + Intronic
917966197 1:180180100-180180122 TGGGATTTGTAGCACAGTTCAGG + Intronic
920227154 1:204447158-204447180 TGGGATGTGGGGCAGAGCTCTGG + Intronic
924754610 1:246930478-246930500 TGGGATGACAAGCCCAGTTAAGG - Intronic
1062846190 10:707687-707709 TGGGGTGTGAAGGGCAATTCTGG - Intergenic
1064303193 10:14141033-14141055 TGGGAGGTGGAGCACAGGCCTGG + Intronic
1066020691 10:31297716-31297738 TGGTATCTGAAGCTCAGTTTGGG + Intergenic
1066309758 10:34184805-34184827 TGAGATGTGAAGCTCCTTTCTGG - Intronic
1067288377 10:44923925-44923947 TTGGGCTTGAAGCACAGTTCTGG - Intronic
1067534960 10:47102284-47102306 AGGGATGTGATGCACAGCACTGG - Intergenic
1067767413 10:49097380-49097402 TGGGATGTCAAGCACAATGGAGG + Intronic
1068730015 10:60347448-60347470 TGGGATTTGACTCACATTTCTGG - Intronic
1069851849 10:71410425-71410447 TGCCATGGGAAGCACAGTGCTGG - Intronic
1070346254 10:75545141-75545163 TTGGATGTTAAGCACATTCCTGG - Intronic
1072556138 10:96515069-96515091 TTTGATGTGAAGCCCAGCTCTGG - Intergenic
1073187876 10:101627692-101627714 TGAGATGTGAAGCACCCTTTGGG - Intronic
1074149456 10:110745268-110745290 TGGGATGTGGAGCACAGGAGGGG - Intronic
1079496668 11:21052208-21052230 TGGGATGTGAAGTAGAGATTAGG + Intronic
1080697416 11:34614788-34614810 TGGAAAGTCAAGCTCAGTTCTGG - Intergenic
1083631647 11:64098388-64098410 TGGGACGGGAAGAACATTTCAGG - Intronic
1084406684 11:68978332-68978354 TGGGCTGTAAAGCACTGTACAGG + Intergenic
1088931837 11:114359078-114359100 TGGTTTTTGAAGGACAGTTCAGG - Intergenic
1088979332 11:114847698-114847720 TCAGATTTGAAGCACACTTCAGG - Intergenic
1089425683 11:118372574-118372596 TGGGGTGAGAAGAACTGTTCGGG - Exonic
1091111546 11:132973608-132973630 TGAGAAGTCAAGCACAGTTAAGG + Intronic
1092897977 12:13032095-13032117 TGGGATGGGAAGCAGACATCAGG - Intergenic
1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG + Intergenic
1097086691 12:56474038-56474060 AGCAATGTGAAGCACAATTCAGG + Exonic
1097233734 12:57526608-57526630 TGGGCTTTGAAGCACAGGGCTGG - Exonic
1098529713 12:71527897-71527919 TGGGCTGTGCAGCACATTGCAGG - Intronic
1100297463 12:93275953-93275975 TGGGAAGTGAAGAGCAGTCCAGG - Intergenic
1101668323 12:106841399-106841421 GGGGAAGTGGAGCACAATTCAGG + Intronic
1103578878 12:121899610-121899632 TGGGATGAGAACCACACATCAGG - Intronic
1105482929 13:20795706-20795728 TGGGATTTGAATCCCAGTCCTGG + Intronic
1105738908 13:23301395-23301417 TGGTATGAGAAACAAAGTTCTGG - Intronic
1108699371 13:52930653-52930675 TGGGATTGGAAACACAGCTCCGG + Intergenic
1109799344 13:67355925-67355947 TGGGATCTGAAGCTTCGTTCTGG - Intergenic
1115378309 14:32703852-32703874 TGTGATGTGAAGCACATCTGAGG + Intronic
1115810683 14:37103744-37103766 TGATATTTGAAGCACAGTTGAGG - Intronic
1117027460 14:51636213-51636235 TGGGATGTGAAGGACAATTGAGG + Intronic
1117337349 14:54766702-54766724 TGGGAGAGGAAGCAGAGTTCCGG - Intronic
1118436127 14:65772282-65772304 TGGTCTGAGAAACACAGTTCCGG + Intergenic
1118556002 14:67022806-67022828 TGGAATGGGAAGCAGAGGTCTGG + Intronic
1118638977 14:67774583-67774605 TGGGATTTGAATCCCAATTCTGG + Intronic
1121460921 14:94077422-94077444 TGGTATGTGCAGCAGAGTCCTGG - Intronic
1124107469 15:26753511-26753533 TGACAAGTGAAGCACAATTCAGG + Intronic
1129273027 15:74429305-74429327 TGGGATGTGAAGCTCAGCCCAGG - Intronic
1129727290 15:77908036-77908058 TGGCACGTGCAGCACAGATCTGG - Intergenic
1129840589 15:78740959-78740981 TGGCACGTGCAGCACAGATCTGG + Intergenic
1132035544 15:98480859-98480881 TTGGATGTGACGCACACGTCGGG + Intronic
1134247002 16:12547546-12547568 GGGGATGTTAACCACAGCTCAGG - Intronic
1143787525 17:9267030-9267052 TGGGAAGTGACACACAGTACTGG - Intronic
1143908014 17:10225296-10225318 TGGGATTTGAATCAAAGATCAGG - Intergenic
1143985264 17:10907622-10907644 TGGGCTGTGACGCACAGATATGG + Intergenic
1145974602 17:28976913-28976935 GGGGATGGGAAGCACAGGACGGG - Intronic
1146678496 17:34790402-34790424 TGGGATGTCCAGCACATTGCAGG + Intergenic
1147471486 17:40666268-40666290 TTGTATCTGGAGCACAGTTCAGG + Intergenic
1147718312 17:42522489-42522511 TGGGGTTTGAAGCAGAGTTCAGG + Exonic
1149487514 17:57054494-57054516 TGGGATCTGAAGCACCTGTCAGG + Intergenic
1154008368 18:10554866-10554888 TGGGATGAGCAGCACATTGCTGG - Intergenic
1156499024 18:37545271-37545293 TGGGATCTCAGGCACAGATCTGG - Intronic
1157192411 18:45592572-45592594 TTGGCTGTGAAGCAGAGCTCTGG - Intronic
1160331445 18:77995790-77995812 TGGGGAGAGAAGGACAGTTCTGG + Intergenic
1163347100 19:16750110-16750132 TGGGAGGTGAAGCCCCTTTCCGG + Exonic
1163875588 19:19865167-19865189 TGGGATGGGATGCTCAGCTCAGG + Intergenic
1165773355 19:38390539-38390561 TGGCATGTGGAGCAGAGGTCAGG + Intronic
1167159456 19:47757417-47757439 TGGGAGGTGAAGCAGAGGTGAGG + Intergenic
1168435876 19:56316377-56316399 TGGGATGTGGAGCACAATAAGGG - Intronic
925991979 2:9261267-9261289 TGGGAGGGGGAGCACAGCTCTGG + Intronic
926096402 2:10083596-10083618 TGGAAGGTGAAGCCCAGTTTGGG + Intergenic
928113513 2:28528582-28528604 TGGGGTTTGAACCAGAGTTCTGG - Intronic
930002539 2:46870803-46870825 TAGGAGATGAATCACAGTTCTGG - Intergenic
930095028 2:47560421-47560443 TGAGAGCTGAAGCACAGTTTGGG - Intronic
930716474 2:54598125-54598147 TGGTATGTGAAGGCCAGTTCTGG + Intronic
934552843 2:95272664-95272686 TGTGTTGTGAAGCTCAGTGCAGG - Intergenic
934576325 2:95403678-95403700 TGGGATGTGAATCCAAGTCCAGG - Intronic
934638508 2:96011507-96011529 TGGGATGTGAATCCAAGTCCAGG - Intergenic
934795149 2:97093904-97093926 TGGGATGTGAATCCAAGTCCAGG + Intronic
935087729 2:99864767-99864789 TGGACTGTGAAGCAGAATTCAGG - Intronic
935347459 2:102121649-102121671 TGAGATGTCAAGCCCAGTTTGGG + Intronic
935847014 2:107176956-107176978 GTGGAGGTGAAGCAAAGTTCTGG - Intergenic
936054619 2:109252850-109252872 AGGTATGTGAAGTACAGTTTGGG + Intronic
936368547 2:111883697-111883719 TGGGATGCTACGCACAGCTCAGG + Intronic
936999845 2:118456353-118456375 TGGGAGGAGAAGCAGAGTTTTGG + Intergenic
939850176 2:147294901-147294923 TGGAATGAGCAACACAGTTCTGG + Intergenic
939881816 2:147639953-147639975 TTGGATGTGGAGAACAGTGCTGG + Intergenic
940551040 2:155157216-155157238 TGGGTTGTAAATCAGAGTTCTGG - Intergenic
943627457 2:190216267-190216289 AGGGATGTGGAGGACAGTTTAGG + Intronic
944070975 2:195668811-195668833 TGGGATGTGACCCAAAGTGCTGG - Intronic
944124375 2:196276576-196276598 TGCGATGTGTAGCACAATTAGGG - Intronic
946485398 2:220096263-220096285 TGGGATGAGGAGCACAGTGATGG + Intergenic
1170394745 20:15914297-15914319 TGGGAGGTGAAGGTCATTTCAGG + Intronic
1173318524 20:41966772-41966794 AGGGATGTGAAGGACCTTTCAGG - Intergenic
1175904284 20:62372000-62372022 TGGGGTGTGAGGCAGAGTCCAGG + Intergenic
1178393226 21:32216314-32216336 TGGAAGGAGAAGAACAGTTCTGG + Intergenic
1180030996 21:45207667-45207689 TGAGCTGTGATGCACAGTGCAGG - Intronic
1181411133 22:22720628-22720650 TGGGCTCAGAAGCAGAGTTCTGG + Intergenic
1182088471 22:27577730-27577752 TGGGATTTGAACCCCAGATCTGG - Intergenic
1182435096 22:30325493-30325515 TGGGATGGAAAGCACACATCAGG + Intronic
1182636272 22:31729801-31729823 TGGGATGATAAGAAAAGTTCTGG + Intronic
1183098228 22:35567338-35567360 AGGGTTGAGAAGCACAGATCTGG + Intergenic
1183289341 22:36989961-36989983 TGGGATGAGAACCACAGTGGGGG - Intergenic
1183335139 22:37242004-37242026 TGGGATTTGAAGCCCAGGTCAGG - Intronic
949744997 3:7280441-7280463 TGGGATTTGAATCACAATCCTGG - Intronic
952279512 3:31909729-31909751 TGGGATGTGAAGAACGGCCCTGG - Intronic
952540792 3:34365466-34365488 TGGGCTGGGAAGCACAGATAAGG - Intergenic
956775982 3:72565850-72565872 TGGGATGTCAAACAAAGCTCTGG + Intergenic
960921511 3:122751614-122751636 TGGGAGGTGAAGCACCTGTCAGG + Intronic
966602038 3:181785548-181785570 TGGTATGTGATGCAGAGTTTAGG - Intergenic
967271499 3:187737111-187737133 TGGGATGGGAAGTCCAGGTCTGG - Intronic
970467403 4:16339121-16339143 TGGAATGTAAAGAAGAGTTCAGG - Intergenic
970745138 4:19285125-19285147 TGGAGTCTGAAGCACAGCTCAGG - Intergenic
970916995 4:21347516-21347538 TGTGATGTGAAGCAGAGCTAGGG + Intronic
971192959 4:24445121-24445143 TTCAATGTGAAGCACTGTTCAGG - Intergenic
975531172 4:75401147-75401169 TGGGCTGTCAAGAACAGATCTGG + Intergenic
975686414 4:76920055-76920077 TGGGATGTGAACCACTGCTCTGG + Intergenic
978334219 4:107648483-107648505 TGGGATGTGAAGCACAGTTCTGG - Intronic
978405723 4:108376821-108376843 GTTGATGTGAAGCACAGTTTTGG - Intergenic
979473246 4:121125586-121125608 TGGCATGTGGACCACAGTTGTGG + Intergenic
980257585 4:130402460-130402482 TGGCAGGTGCAGCACAGCTCAGG + Intergenic
980873341 4:138635227-138635249 TAGGATATGAAGTACAGTTCAGG - Intergenic
981917718 4:150052796-150052818 TGGGATGTGAGGCAGCGTTGGGG + Intergenic
983874019 4:172855246-172855268 TGGTATGTGAATCACATTTTAGG - Intronic
988255534 5:28814883-28814905 TGGGATGTGAAGTATATCTCAGG + Intergenic
991963846 5:72072071-72072093 TAGGATGATAAGCCCAGTTCTGG - Intergenic
994535368 5:101023901-101023923 TTGGATGGGAAGCACACTGCAGG + Intergenic
997473654 5:134130479-134130501 TGGCTTGGGAAGCACAGTGCAGG - Intronic
997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG + Intronic
997616240 5:135248059-135248081 TGGCATGTTAAGCTCAGTGCTGG + Intronic
998006846 5:138662738-138662760 TGGGATGTTATGCACAGTAATGG + Intronic
998379657 5:141715289-141715311 TGGGCTCTGAAGCACAGAGCTGG + Intergenic
998793458 5:145791619-145791641 TGGGAAGAGAAACAAAGTTCTGG + Intronic
998812017 5:145975818-145975840 AGGGATGTGAGGCACAGAGCAGG - Intronic
999061844 5:148644183-148644205 GGGGATGTGAACCACACTTTTGG - Intronic
999848298 5:155509413-155509435 TGGGTAGTGTAGCATAGTTCTGG - Intergenic
1000101427 5:158020820-158020842 TGAGATCTGGAGCACAGATCTGG + Intergenic
1000203113 5:159031219-159031241 TGGGATGTGGAGAAGAGGTCAGG + Intronic
1001398098 5:171431021-171431043 TGTGATGTGACGCACATTTGTGG + Intronic
1002560126 5:180075687-180075709 TGGGGTTTGTAGCACTGTTCAGG - Intergenic
1007326118 6:41061365-41061387 CGGAATGTGGAGTACAGTTCCGG + Exonic
1013374286 6:109499083-109499105 TGGAATTTGCAGCAGAGTTCAGG - Exonic
1013445636 6:110223492-110223514 TATGCAGTGAAGCACAGTTCCGG - Intronic
1014032342 6:116719976-116719998 TGGGATATAAAGCACAGTGGAGG - Intronic
1017444605 6:154496015-154496037 TGGTCTGTGAATCACAGTTTGGG - Intronic
1017774059 6:157666560-157666582 TTGGCTGTGAAGCTCTGTTCTGG - Intronic
1018894932 6:168007706-168007728 TGGGTTGTGAATCAGAGTTAGGG + Intronic
1019602716 7:1893294-1893316 TGGGATGGGAAGCAGAGTGGCGG + Intronic
1022570707 7:31450754-31450776 TGGTATTTGAAGCACAATACTGG - Intergenic
1024613978 7:51092060-51092082 TGTGATGTGAGGCAGAGCTCAGG - Intronic
1024645221 7:51365327-51365349 TGGGATGGGACGTACAATTCAGG + Intergenic
1026308178 7:69160669-69160691 TGGGATCTGAATCACAATTAAGG - Intergenic
1026494302 7:70889102-70889124 GGAGATGGGAAGCACAGTTCAGG + Intergenic
1029013072 7:97283045-97283067 TGGGTTCTGAAAAACAGTTCTGG - Intergenic
1029184567 7:98729474-98729496 TGGCATGTGAGGGACAGATCTGG - Intergenic
1029633680 7:101769457-101769479 TGCTATGTCAAGCACTGTTCCGG - Intergenic
1030334723 7:108312933-108312955 TGGGATGTCCACCAGAGTTCTGG - Intronic
1031058061 7:117015700-117015722 TGGGAGGTGAAGCAGTGATCAGG + Intronic
1033450374 7:141457020-141457042 TAGGATGGGAAGGACAGTTCTGG - Intronic
1034424717 7:151008445-151008467 TGGGAAGGGACGCACAATTCGGG - Intronic
1037534640 8:19813112-19813134 TGGGATTAGAAGCACAGGTGAGG + Intergenic
1040598463 8:48862157-48862179 TGGGGTGTGAAGCACAGGGCTGG + Intergenic
1042050365 8:64697733-64697755 TGGAATGTAGAGCACAGTTTGGG - Intronic
1042340804 8:67677031-67677053 GGCGTTGTGCAGCACAGTTCGGG - Intronic
1042798237 8:72687942-72687964 TGGGCTATGGAGCACAGTTCAGG + Intronic
1044710480 8:95052664-95052686 TGGGCTATGAACCACTGTTCTGG - Intronic
1046130202 8:109957445-109957467 TGTGCTCTGAAGAACAGTTCTGG + Intergenic
1047591253 8:126329836-126329858 TGGGATGTGAAGACCAGTAGGGG + Intergenic
1047834848 8:128678000-128678022 TGGGATGTGAAAAACTGTTGAGG - Intergenic
1055489017 9:76785417-76785439 TGGGATGTGAAGCAAAGGCAGGG + Intronic
1056823752 9:89862789-89862811 TGGGATGTGAGGGAGACTTCTGG - Intergenic
1058957616 9:109963698-109963720 TGGGAGGTGAAGCACAGTCAGGG - Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060624974 9:125103488-125103510 TGGGATGTAAAAGACATTTCTGG - Intronic
1186630451 X:11342950-11342972 TGGAATCTGAAGCCCATTTCAGG - Intronic
1196942731 X:120793459-120793481 TGGCATGTATAGCACAGTCCTGG - Intergenic
1198445195 X:136706516-136706538 TGGGATGTGAAGAAAGGGTCAGG - Intronic
1199423558 X:147675597-147675619 TGGGAAGTGGAGCACAGGTCAGG + Intergenic